To review:
Based on the DNA sequence encoding five amino acid polypeptide and answer the following:
Identify the template and coding strands of DNA and locate the sequence encoding five amino acid of the polypeptides.
Give the sequence and polarity of mRNA encoding the polypeptide.
Give the polypeptide sequence and identify the N- and C- terminus.
Identify the region encoding the shine dalgarno sequence.
Explain the function of Shine dalgarno sequence.
Introduction:
In molecular biology, the central dogma describes the formation of polypeptide chain from the template DNA strand through the intermediate formation of mRNA.
Transcription Translation
DNA —- ———–> mRNA – ———-> polypeptide
The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is the triplet of nitrogen bases coding the specific amino acids. These amino acids are bound together by peptide bond to form polypeptides.
Want to see the full answer?
Check out a sample textbook solutionChapter 9 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
- Decode the unknown word using the genetic code and fill out the missing nucleotides. Translate the generated mRNA sequence using the universal genetic code table and the information derived from the previous steps. Determine the unknown word by arranging the single letter amino acid code of the hypothetical protein produced bound by the start and stop codon.arrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forwardBased on the N-terminal amino acid sequence, what is the approximate half-life of the protein after methionine is cleaved off?arrow_forward
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG Garrow_forwardGiven the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)arrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forward
- For the following DNA bases, give the complementary mRNA code that would be transcribed from these bases: AGCTAATCGGCTACCAGGTACGGATATTCCarrow_forwardThe bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.arrow_forwardThe bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAarrow_forward
- Decode the unknown word using the genetic code and fill out the missing nucleotides. Translate the generated mRNA sequence using the universal genetic code table and the information derived from the previous steps. Determine the unknown word by arranging the single letter amino acid code of the hypothetical protein produced bound by the start and stop codon.arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education