Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 21P
In an experiment to decipher the genetic code, a
a. a doublet without overlaps?
b. a doublet with overlaps?
c. a triplet without overlaps?
d. a triplet with overlaps?
e. a quadruplet without overlaps?
f. a quadruplet with overlaps?
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
A peptide is produced in two different cells. The primary structure is the same in both cells, but
the amount of peptide is increased in one cell. What could be happening to the pre-mRNA or
mRNA transcript within the cell that has the higher amount of this peptide?
A. It has a shorter Poly-A tail
B. An alternative polyadenylation (Poly-A) site is being selected
C. Leaky scanning occurred
D. B and C are both correct
OE. None of the above
In the human enzyme encoded by the DCXR
gene, a mutation in the protein coding region
of the DCXR gene is described as 583 AC
(deletion of 1 nucleotide at position +583). At
the protein level, the mutation would be
described as: a. a nonsense b. a missense c.
A geneticist induces a mutation in eukaryote cells. The mutation results in an inability to form the poly(A) tail during processing of pre-mRNA. What does this mean for the mature mRNA and what will be the effect on these cells?
Possible Answers:
A. The mRNA will be spliced, but will not have a 5' cap.
B. The mRNA will likely be degraded.
C. The mRNA will not be cleaved.
D. The mRNA will have too many Gs and Cs.
Chapter 9 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 9 - 9.1 Some proteins are composed of two or more...Ch. 9 - In the experiments that deciphered the genetic...Ch. 9 - 9.3 Several lines of experimental evidence pointed...Ch. 9 - Outline the events that occur during initiation of...Ch. 9 - 9.5 A portion of a DNA template strand has the...Ch. 9 - Describe three features of tRNA molecules that...Ch. 9 - Prob. 7PCh. 9 - For each of the anticodon sequences given in the...Ch. 9 - What is the role of codons UAA, UGA and UAG in...Ch. 9 - Compare and contrast the composition and structure...
Ch. 9 - Consider translation of the following mRNA...Ch. 9 - Prob. 12PCh. 9 - Third-base wobble allows some tRNAs to recognize...Ch. 9 - The genetic code contains 61 codons to specify the...Ch. 9 - 9.15 The three major forms of (,, and ) interact...Ch. 9 - The accompanying figure contains sufficient...Ch. 9 - 9.17 The line below represents a mature eukaryotic...Ch. 9 - 9.18. After completing Problem, carefully draw a...Ch. 9 - 9.19 Define and describe the differences in the...Ch. 9 - 9.20. Describe the roles and relationships...Ch. 9 - 9.21 In an experiment to decipher the genetic...Ch. 9 - Identify and describe the steps that lead to the...Ch. 9 - Prob. 23PCh. 9 - Har Gobind Khorana and his colleagues performed...Ch. 9 - 9.25 An experiment by Khorana and his colleagues...Ch. 9 - Prob. 26PCh. 9 - 9.27 The mature transcribed from the human gene is...Ch. 9 - Prob. 28PCh. 9 - Prob. 29PCh. 9 - Prob. 30PCh. 9 - 9.31 A portion of the coding strand of for a gene...Ch. 9 - A eukaryotic mRNA has the following sequence. The...Ch. 9 - Diagram a eukaryotic gene containing three exons...Ch. 9 - Prob. 34PCh. 9 - 9.35 Table lists and gene sequences for or ...Ch. 9 - Prob. 36PCh. 9 - In terms of the polycistronic composition of mRNAs...Ch. 9 - Prob. 38PCh. 9 - 9.39 Answer the following questions about the...Ch. 9 - 9.40 for each of the following anticodon...Ch. 9 - Prob. 41PCh. 9 - Prob. 42P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How would the artificial mRNA5′. . . GUGUGUGU . . . 3′be read according to each of the following models forthe genetic code?a. two-base, not overlappingb. two-base, overlappingc. three-base, not overlappingd. three-base, overlappinge. four-base, not overlappingarrow_forwardDNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. Identify and label the exons and introns in this hybridized structure.arrow_forwardDNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. How many introns and exons are there in this gene? Explain your answer.arrow_forward
- The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.arrow_forwardConsider the following gene with their respective introns and exons 5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequencearrow_forwardNuclear (N) and cytoplasmic (C) mRNA samples of a gene with 2 exons and one intron run on an agarose gel along with a size marker, are shown in the gel figure below. Ntds = nucleotides 3. What is the length of the primary mRNA? HINT: Check question 3c RNA sample: N a. C ntds 1900- b. What is the length of the processed MRNA? 1250 1000 800- 650 с. If the 1250 nucleotide and 650 nucleotide fragments are spliced mRNA intermediates as indicated in the splicing diagram below, what is the size in nucleotides of Exon 1 & Exon 2. Size 1 Markers Exon Intran Exon pre-MRNA AG GU (1) (2) I spliced MRNA 2.arrow_forward
- 4a) Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence: 5'AUGCGACCUAGCUAUGGA3' b) How many different mRNA sequences could code for the protein sequence you determined in 4a? Explain how you came up with your answer (don't write out all the possible mRNA sequences - just explain your logic). Can you help with 4a and sub question barrow_forwardFor each example: a. fill in the complimentary DNA strand b. fill in the correct mRNA bases by transcribing the bottom DNA code c. fill in the correct tRNA bases d. translate the MRNA codons to find the correct amino acids Example #1 5' 3' (A (A DNA MRNA TRNA Amino Acidsarrow_forwardWhat potential polypeptides can be produced from the following mRNA sequence? There are more than one answer.. 5’ ...GGAGCUCGUUGUAUU... 3’ a. ser-ser-leu-tyr b. leu-cys-cys-ser-arg c. gly-ala-ser-trp-ile d. gly-ala-arg-cys-ile e. glu-leu-val-val f. You can't translate without a start codon. I know (d) is one of the answer but I'm stuck on how to find the rest. Please help.arrow_forward
- Without using your textbook, determine what protein sequence would be translated from the mRNA sequence 5’-UAUACUCCAUGC-3 A. Pro-Arg-Gly-Leu B. Leu-Arg-Cys-Thr C. Met-Cys-Ala-Ala D. Tyr-Thr-Pro-Cys E. None of the abovearrow_forwardExons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and2 are 546 bp and 466 bp respectively.a. Draw this gene showing the promoter, exons, introns and transcription initiationsites.b. This gene is found to encode two mRNAs. One of these mRNAs is 224 bp in shorter thanthe other.i. What is the biological process giving rise to this phenomenon called?What are the sizes of the two mRNAs (in bp) produced from this gene?arrow_forwardBelow is a graphical representation of eukaryotic precursor mRNA. A. Outline each modification that must happen to get a mature m-RNA. B. How does the absence of introns in prokaryotic genes affect prokaryotic gene expression? C. How will gene expression be affected if all of the spliceosomes are removed from the bacteria sample? Explain.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY