Concept explainers
To analyze:
Table-C contains DNA-sequence information compiled by Marilyn Kozak (
Introduction:
Consensus sequences are a short stretch of DNA sequences that are commonly located nucleotides found at a specific location of DNA and RNA. These sequences are used for inter or intramolecular interactions. These sequences are similar in structure and function in all organisms. The consensus sequence is a calculated order that states the most frequent nucleotide at that position in the alignment.
Want to see the full answer?
Check out a sample textbook solutionChapter 9 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
- The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASEarrow_forwardUse the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash.arrow_forwardTranscribe and translate the mutated sequence #3. Determine the consequence, if any, for each mutation. You will need to use your codon charts in your ISN. Practice with both charts.arrow_forward
- Below is a short nucleotide sequence from a gene. Use the Internet(e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what genethis sequence is from. Also, determine the species in which thisgene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC GCCACTGATCATTA–3’arrow_forwardIdentify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequencesarrow_forwardThe consensus sequence of the protospacer adjacent motif (PAM) sequence in bacterial strain A is 5'-NGG-3, whereas in bacterial strain B the consensus PAM sequence is 5'-NGRRN-3: Calculate the frequency at which each of these PAM sequences will occur in DNA using N = any nucleotide and R = purine base. Bacterial strain A: PAM sequence occurs once in every 16 nucleotides Bacterial strain B: PAM sequence occurs once in every 32 nucleotides Bacterial strain A: PAM sequence occurs once in every 32 nucleotides Bacterial strain B: PAM sequence occurs once in every 16 nucleotides Bacterial strain A: PAM sequence occurs once in every 32 nucleotides Bacterial strain B: PAM sequence occurs once in every 32 nucleotides Bacterial strain A: PAM sequence occurs once in every 16 nucleotides Bacterial strain B: PAM sequence occurs once in every 16 nucleotidesarrow_forward
- Given the mRNA sequence below, 5'-UUCCCAAAGUAU-3'Answer the following below:1. What is the sequence of amino acids using the table of genetic code? (three-letter abbreviation)2. Given the situation that a mutation occurs by substitution of the 12th nucleotide with cytidine 5'-monophosphate, what is the resulting amino acid sequence?3. What type of mutation occured? Specific what type under frameshift and point mutationsarrow_forwardState the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixarrow_forwardTranscribe and translate the mutated sequence #1. Determine the consequence, if any, for each mutation. You will need to use your codon charts in your ISN. Practice with both charts.arrow_forward
- Representations of sequencing chromatograms for variants of the a chain of human hemoglobin are shown here. Match each of the variants with the corresponding amino acid change. You can use the codon table to decode each amino acid sequence. For example, the first triplet encodes for Val. Normal Chongqing ddATP ddCTP ddGTP ddTTP Pro to Thr Gly to Asp Leu to Arg Karachi Swan River Answer Bank Ala to Pro Asp to Gly Pro to Ala Arg to Leu Asp to Asn Arg to Valarrow_forwardFor each organism, compute the ratio of (A + G)/(U + C).arrow_forwardWith regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning