Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 4P
Outline the events that occur during initiation of translation in
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Please describe the four-step process of the elongation during protein translation in bacteria.
For each of the following initiation factors, how would eukaryoticinitiation of translation be affected if it were missing?A. eIF2B. eIF4C. eIF5
Describe in detail the steps of translation termination in bacteria. Explain what happens.
Chapter 9 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 9 - 9.1 Some proteins are composed of two or more...Ch. 9 - In the experiments that deciphered the genetic...Ch. 9 - 9.3 Several lines of experimental evidence pointed...Ch. 9 - Outline the events that occur during initiation of...Ch. 9 - 9.5 A portion of a DNA template strand has the...Ch. 9 - Describe three features of tRNA molecules that...Ch. 9 - Prob. 7PCh. 9 - For each of the anticodon sequences given in the...Ch. 9 - What is the role of codons UAA, UGA and UAG in...Ch. 9 - Compare and contrast the composition and structure...
Ch. 9 - Consider translation of the following mRNA...Ch. 9 - Prob. 12PCh. 9 - Third-base wobble allows some tRNAs to recognize...Ch. 9 - The genetic code contains 61 codons to specify the...Ch. 9 - 9.15 The three major forms of (,, and ) interact...Ch. 9 - The accompanying figure contains sufficient...Ch. 9 - 9.17 The line below represents a mature eukaryotic...Ch. 9 - 9.18. After completing Problem, carefully draw a...Ch. 9 - 9.19 Define and describe the differences in the...Ch. 9 - 9.20. Describe the roles and relationships...Ch. 9 - 9.21 In an experiment to decipher the genetic...Ch. 9 - Identify and describe the steps that lead to the...Ch. 9 - Prob. 23PCh. 9 - Har Gobind Khorana and his colleagues performed...Ch. 9 - 9.25 An experiment by Khorana and his colleagues...Ch. 9 - Prob. 26PCh. 9 - 9.27 The mature transcribed from the human gene is...Ch. 9 - Prob. 28PCh. 9 - Prob. 29PCh. 9 - Prob. 30PCh. 9 - 9.31 A portion of the coding strand of for a gene...Ch. 9 - A eukaryotic mRNA has the following sequence. The...Ch. 9 - Diagram a eukaryotic gene containing three exons...Ch. 9 - Prob. 34PCh. 9 - 9.35 Table lists and gene sequences for or ...Ch. 9 - Prob. 36PCh. 9 - In terms of the polycistronic composition of mRNAs...Ch. 9 - Prob. 38PCh. 9 - 9.39 Answer the following questions about the...Ch. 9 - 9.40 for each of the following anticodon...Ch. 9 - Prob. 41PCh. 9 - Prob. 42P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- During the initiation of translation in bacteria, the small ribosomal subunit binds to which consensus sequence?arrow_forwardResearchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents the formation of peptide bonds during translation. A model of the translation process is shown in the diagram. Which of the following describes where in the model chloramphenicol acts to interfere with the production of proteins from DNA? during initiation during elongation during termination during protein releasearrow_forwardGive the elongation factors used in bacterial translation and explain the role played by each factor in translation.arrow_forward
- Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA. Include names of any relevant sequences on the mRNA, proteins involved, including ribosomal subunits.arrow_forwardExplain why a minimum of 32 tRNAs are required to translate the “standard” genetic code.arrow_forwardExplain what is meant by the coupling of transcription and translation in bacteria. Does coupling occur in bacterial and/or eukaryotic cells? Explain.arrow_forward
- A segment of template DNA is known to contain the following base sequence: 3' GATACCTTTGTGTAGTCATCTT 5' a) Write the mRNA that would be transcribed from this DNA fragment. b) Highlight the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. asap pleasearrow_forwardIn EUKARYOTIC translation, how does initiation of translation occur? a) What components of the mature mRNA are involved (2 components) and b) what proteins are involved (at least 2 proteins)?arrow_forwardMany antibiotics are effective as drugs to fight off bacterial infections because they inhibit protein synthesis in bacterial cells. Using the information provided in the following table that highlights several antibiotics and their mode of action, discuss which phase of translation is inhibited: initiation, elongation, or termination. What other components of the translational machinery could be targeted to inhibit bacterial protein synthesis? Antibiotic Action 1. Streptomycin Binds to 30S ribosomal subunit 2. Chloramphenicol Inhibits peptidyl transferase of 70S ribosome 3. Tetracycline Inhibits binding of charged tRNA to the A site of the ribosome 4. Erythromycin Binds to free 50S particle and prevents formation of 70S ribosome 5. Kasugamycin Inhibits binding of tRNAfMet 6. Thiostrepton Prevents translocation by inhibiting EF-Garrow_forward
- A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)arrow_forwardExplain the function of the Shine-Dalgarno sequence in prokaryotic protein translation. Where is it located?arrow_forwardThe following sequence represents a few codons present in one strand of DNA.Using this strand of DNA as a template strand for transcription, you are required to synthesize a new RNA strand. A) Show the codons that will be present on the RNA strand. B) Using the universal genetic code, provide the amino acids on the protein that will be translated from the RNA strand. 3’ TAC ATG GTT GTG CTA ATT 5’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license