Microbiology with Diseases by Body System (5th Edition)
5th Edition
ISBN: 9780134477206
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 2TMW
Summary Introduction
To tell:
The translation can begin even before the mRNA transcription is completed in the bacteria. Why this does not occur in eukaryotes.
Introduction:
Translation is a process where the genetic information carried out by the messenger RNA is converted into the specific amino acid sequence. The sequential amino acids together form the polypeptide chains of proteins.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which of the following parts of translation is significantly different in eukaryotes and prokaryotes?Question 25 options:
A)
the presence of a start codon
B)
the genetic code
C)
Initial binding of mRNA by ribosomes
D)
movement of mRNA and tRNA through the 3 sites on the ribosome
E)
binding of tRNAs to mRNAs
Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents the formation of peptide bonds during translation. A model of the translation process is shown in the diagram.
Which of the following describes where in the model chloramphenicol acts to interfere with the production of proteins from DNA?
during initiation
during elongation
during termination
during protein release
Which statement is false:
A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide
B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down
C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon
D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome
E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
Chapter 7 Solutions
Microbiology with Diseases by Body System (5th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the mature mRNA are involved (2 components) and b) what proteins are involved (at least 2 proteins)?arrow_forwardThe following mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA UCC UCC ACU CCU UGA-3' Use the following codons and the amino acids they encode: AUG = Start or Met; UUU, UUC = Phe; UUA, UUG = Leu; UCU, UCC = Ser; CCU, CCC = Pro; ACU, ACC = Thr; UGA = Stop. Select one: O a. Phe-Leu-Ser-Ser-Thr-Pro O b. Met-Phe-Leu-Ser-Ser-Thr-Pro O c. Thr-Phe-Thr-Phe-Leu-Ser-Ser-Thr-Pro Od. Met-Phe-Leu-Ser-Ser O e. Thr-Phe-Thrarrow_forwardIn bacterial genes, as soon as any partial mRNA transcript is produced by the RNA polymerase system, the ribosome assembles on it and starts translating. Draw a diagram of this process, identifying 5′ and 3′ ends of mRNA, the COOH and NH2 ends of the protein, the RNA polymerase, and at least one ribosome. Why couldn’t this system work in eukaryotes?arrow_forward
- Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately positioned in a ribosome at the initiation of translation? O binding between the mRNA Shine-Dalgarno sequence and ribosomal proteins base-pairing between the mRNA Shine-Dalgarno sequence and rRNA of the small ribosomal subunit O binding between ribosomal proteins and the initiation factor that base-pairs with the start codon O base-pairing between the mRNA Shine-Dalgarno sequence and rRNA of the large ribosomal subunitarrow_forwarda) The deacetylation of histones generally causes gene inactivation. True or false? b)During eukaryotic translation, the first contact between the ribosome and the mRNA is usually made when the small ribosomal subunit directly binds to the translational start site (Kozak sequence) on the mRNA. True or false? c)The termination of translation is carried out by a single tRNA molecule that recognizes all three stop codons. True or false? d) The deamination of cytosine, which produces uracil, is less likely to be repaired, compared to the deamination of 5-methylcytosine, which produces thymine.True or false? e)An HLH-bHLH heterodimer can bind DNA. True or false? F)Chromatin remodeling complexes posseses ATPase activity. True or false? g)Histone methylation generally causes gene inactivation. True or false? h) A pre-mRNA is cleaved downstream of its polyA signal before the transcription terminates. True or false? i) During X chromosome inactivation in female mammals, most genes are repressed…arrow_forwardFor translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the ribosome. b) The tRNA is the same thing as the amino acid. c) There are two binding pockets within the ribosome where different tRNAs will bind to the mRNA. d) The first codon that is recognized by the ribosome is UAG e) The ribosome can bind to the mRNA in any location.arrow_forward
- The synthesis of multiple different protein isoforms from just one gene in eukaryotic cells would most likely result from: polycistronic mRNAs exon shuffling alternative splicing intron shufflingarrow_forwardPut the following events of elongation in prokaryotic translation in chronological order. 1. Binding of mRNA with small ribosomal subunit 2. Recognition of initiation codon 3. Complementary base pairing between initiator codon and anticodon of initiator tRNA 4. Base pairing of the mRNA codon following the initiator codon with its complementary tRNA 5. Attachment of the large subunit 2, 1, 4, 3, 5 5, 4, 3, 2, 1 1, 2, 3, 5, 4 1, 2, 3, 4, 5arrow_forwardAn RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg)arrow_forward
- What are two advantages for circularizing the mRNA during the process of eukaryotic translation? (Select two correct answers) mRNA circularization ensures that translation terminates at the proper termination codons. mRNA circularization facilitates the binding of the ribosome to the Shine-Dalgarno sequence. mRNA circularization ensures that a full-length mRNA is used in the process of translation. mRNA circularization eliminates the requirement for translation factors in the process of translation initiation. mRNA circularization allows for a more efficient re-initiation of the translation process during repeated cycles of translation.arrow_forwardMany antibiotics are effective as drugs to fight off bacterial infections because they inhibit protein synthesis in bacterial cells. Using the information provided in the following table that highlights several antibiotics and their mode of action, discuss which phase of translation is inhibited: initiation, elongation, or termination. What other components of the translational machinery could be targeted to inhibit bacterial protein synthesis? Antibiotic Action 1. Streptomycin Binds to 30S ribosomal subunit 2. Chloramphenicol Inhibits peptidyl transferase of 70S ribosome 3. Tetracycline Inhibits binding of charged tRNA to the A site of the ribosome 4. Erythromycin Binds to free 50S particle and prevents formation of 70S ribosome 5. Kasugamycin Inhibits binding of tRNAfMet 6. Thiostrepton Prevents translocation by inhibiting EF-Garrow_forwardThe following fictitious double-stranded bacterial DNA sequence codes for a fictitious protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. Transcription begins with and includes the red underlined A/T (top strand/bottom strand) base pair. This is a bacterial sequence, so there are no introns. 5'GTGTCCGTATGATATTGTGAGATGTTATATCCCGCCGTCAACACCATAAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3′ 3' CACAGGCATACTATAACACTCTACAATATAGGGCGGCAGTTGTGGTATTTTGTCCTAT TAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5′ a) Which strand is used as a template for transcription, the top or the bottom? b) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends. c) What is the translation of the first 15 nucleotides of the mRNA? d) Do the underlined nucleotides TAA encode a stop codon for the protein? Explain. e) A mutation occurs which results in the insertion of an extra G/C (top strand/bottom…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license