Microbiology with Diseases by Body System (5th Edition)
5th Edition
ISBN: 9780134477206
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 14MC
Summary Introduction
Introduction:
Transposons are the DNA segments that move from one place to another place in the same or different DNA molecules. They are also known as transposable elements. This could sometimes cause mutations and alterations in the genetic identity of the individuals.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Bacteria exposed to viruses incorporate sections of the virus’s DNA into the CRISPR array sequences in their genome. This mechanism allows bacteria to fight off the viruses, like an immune response: the information in CRISPR spacers served as “coordinates” for recognizing and cutting up invading DNA sequences. Describe what might happen under the conditions described after a bacteriophage infects a bacterial cell and releases its DNA into the bacterial cell.
Explain why:
1. The invading phage DNA is recognized by the Cas proteins but not inserted into the CRISPR array region of the bacterial genome: The bacteria will be unable to elicit an immune response and will succumb to the phase infection
2. The cas genes on the bacterial genome contains a missense mutation that increases its cleavage/cut activityThe bacteria will elicit an immune response that will successfully fight the phage infection
In the 1953 study by Hershey and Chase
A. 32P was found in supernatants after T2 infection
B. 35S was found in bacterial pellets after T2 infection
C. E. coli genomes were inherited after T2 infection
D. RNA was excluded as THE heritable material
E. T2 coats were removed with a blender after initial phage binding
91) The NDV virus
a. The mesogenic ND is less virulent than lentogenic than NDV
b. The antigenomic copy is the template for both making genome and making subgenus
c. The RNA polymerase is only made in the first round of translation
d. The Fusion protein is the virulent protein
Chapter 7 Solutions
Microbiology with Diseases by Body System (5th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A man was brought to the hospital showing "pneumonia"-like symptoms. They took the viral load and determined this to be the new RNA retrovirus infecting lung cells. Since antibodies were unavailable, doctors decided to treat him with drugs. Which of the following would most benefit the patient? A. Drug A is an inhibitor of the binding of 4OS with 60S ribosome of the lung cells. B. Drug B is a structural analogue of the viral peptide that binds to the receptor of the host cell enabling viral entry into the cell. C. Drug C is a polar molecule that inhibits the lytic enzymes activated upon viral infection. D. Drug D is an inducer of a proteolytic enzyme. E. Drug E is a steroid that binds at the regulatory site of a gene causing the synthesis of a repressor that binds at the gene site for the receptor.arrow_forwardBacteria exposed to viruses incorporate sections of the virus’s DNA into the CRISPR array sequences in their genome. This mechanism allows bacteria to fight off the viruses, like an immune response: the information in CRISPR spacers served as “coordinates” for recognizing and cutting up invading DNA sequences. Describe what might happen under the conditions described after a bacteriophage infects a bacterial cell and releases its DNA into the bacterial cell. Explain why: The cas genes on the bacterial genome contains a frameshift deletion mutation that alters the function of the protein The bacteria will be unable to elicit an immune response and will succumb to the phase infectionarrow_forwardA particular strain of λ (lambda) can lysogenize its E. coli host at 30°C, but not at 42°C. Could a temperature-sensitive mutation in the int (integrase) gene explain this phenotype? A. There is insufficient information to answer the question. B. No C. Yesarrow_forward
- Which ONE of the following genetic patterns defines a patient with acute myeloid leukaemia with the most favourable prognosis? Select one: A.Deletion of chromosome 5 B.Normal karyotype with FLT3 tyrosine kinase domain mutation C.t(8;21) translocation D.Deletion of chromosome 7arrow_forwardYou are determined to produce an antiserum for the next pandemic that has hit the world. You have found a gene of interest in an animal in the rainforest which produces a unique protein that blocks the reproduction of the pathogen that now plagues the world. You wish to mass produce this protein using bacteria.arrow_forwardWhy are vaccines and/or passive immunization the method of choice in the treatment or prevention of viral infections? A. There are no known inhibitors to reverse transcription B. Viruses are non-living and do not have their own genetic mechanisms to reproduce by themselves hence host cells must rely on targeting the virus or their products. C. Antibodies prevent replication of viral genome D. Antibodies prevent transcription and translation of viral genomes E. All of thesearrow_forward
- You would like to create an anti-viral medication that is active against both H5N2 and H5N1 strains of influenza. The best drug target would be: a. ribosomal protein production b. Hemagglutinin-mediated fusion c. Neuroaminidase-mediated buddingarrow_forwardThe advantage of yeast cells over bacterial cells to express human proteins is that: a. yeast cells grow faster b. yeast cells are easier to manipulate genetically c. yeast cells are eukaryotic and modify proteins similarly to human cells d. yeast cells are easily lysed to purify the proteinsarrow_forwardDefine the following terms: a. cell transformation b. oncogene c. apoptosis d. early response gene e. delayed response genearrow_forward
- The COVID-19 vaccines are RNA-based (the RNA codes for a viral antigen). Nucleic acid-based vaccines have been discussed for awhile, but I was surprised that the companies decided on an RNA-based vaccine instead of a DNA-based one (given the instability of RNA compared to DNA). Use your knowledge of molecular biology to discuss the advantages of an RNA-based vaccine over a DNA-based vaccine.arrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardMatch items in Column A with most related ones in B. Write the letters on the space provided.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License