Microbiology with Diseases by Body System (5th Edition)
5th Edition
ISBN: 9780134477206
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 12CT
Hydrogen bonds between complementary
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?
Which of the following does NOT describe DNA as it occurs in Eukaryotic cells. CHOOSE ALL THAT APPLY:
1. nitrogenous bases of opposite strands are paired through covalent bonds
2. base pairs are stacked 3.4 A (0.34 nm) apart
3. the two strands of one double helix are complementary
4. two long polynucleotide chains
5. there are 20 base pairs per each turn of a double helix
6. adenine pairs with thymine of the neighboring nucleotide in a single DNA strand
7. bases face outside of the double helix
8. consecutive nucleotides of a single DNA strand are linked by hydrogen bonds
9. here are A-T and G-C pairs in DNA double helix
10. sugar-phosphate backbone of a single DNA strand is formed by linking deoxyribose units and phosphate groups through phosphodiester bonds
11. the two strands of one helix are antiparallel
12.double helix
13. the larger major groove alternates with the smaller minor groove along the length of the double stranded DNA
I tried 2,3,4,9,10,11,12,13 together and got it…
Why do you think it is important that the sugar-phosphate backbone of DNA be held together by covalent bonds while the two strands of double stranded DNA are held together by hydrogen bonds?
Chapter 7 Solutions
Microbiology with Diseases by Body System (5th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?arrow_forwardLike DNA, RNA follows base-pairing rules. Experiment to find which RNA nucleotide on the right side of the Gizmo will successfully pair with the thymine at the top of the template strand of DNA. (NOTE: The DNA on the right side is the template strand.) Which RNA base bonded with the thymine?arrow_forwardWhich of the following conventions is used to specify the sequence of bases in DNA a) The sequence begins with the nucleotide that has a free 3' terminus b) The sequence begins with the nucleotide that has a free 5' terminus c) The sequence begins from the end closest to the first adenine d) The sequence begins from the end closest to the first thyminearrow_forward
- An RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G = 15%. (A) Is this RNA molecule single-stranded or double stranded? How can you tell? (B) What would be the percentage of each of the bases in the template strand of the DNA that contains the gene for this RNA?arrow_forwardA DNA sequence consists of a string of elements called nucleotides, in a defined order. Suppose the DNA sequence of a virus is 20 nucleotides long. If each nucleotide can be either a G, T, C, or A, how many different sequences are possible?arrow_forwardOne strand of a double-helical DNA has the sequence (5′)GCGCAATATTTCTCAAAATATTGCGC(3′). Write the base sequence of the complementary strand. What special type of sequence is contained in thisDNA segment? Does the double-stranded DNA have the potential to form any alternative structures?arrow_forward
- A strand of nucleic acid is defined by its sequence of nucleotides: A, C, T, and G. How many different sequences are possible for a nucleic acid that is 200 nucleotides long? How does that number compare to the estimated number of atoms in the universe, which is approximately 1080?arrow_forwardIf the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of the complementary strand?arrow_forwardGiven the following sequence for one strand of a double-stranded oligonucleotide: 5'ACCGTAAGGCTTTAG3' (a) Write the sequence for the complementary DNA strand. (b) Suppose you knew that the strand shown above had phosphate on both ends. Using an accepted nomenclature, write the sequence so as to show this. (c) Write the sequence of the RNA complementary to the strand shown above.arrow_forward
- Total nucleic acids are extracted from a growing culture of yeast cells. They are then mixed with specialized beads to which the single-stranded DNA molecule with sequence 5’-TTTTTTTTTTTTTTTTTTTTTTTTT-3’ has been covalently attached to the surface (see image to the right, where each black line represents a polynucleotide sequence). After a short incubation time, the beads are removed from the mixture. When you analyze the cellular nucleic acids stuck to the beads, which type of nucleic acid (i.e. DNA, rRNA, etc.) do you expect to be the most abundant? Why?arrow_forwardA) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the complementary base sequence for the matching strand in the DNA section shown below.5’ – C T G T A T A C G T T A – 3’ Please answer both partsarrow_forwardWhat sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to the sequence 5′ T-A-T-G-C-A-G 3′ on the other strand?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License