Whether one can reach an unambiguous conclusion from the given data should be determined. Concept Introduction : The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 30, Problem 1P

Interpretation Introduction

Interpretation:

Whether one can reach an unambiguous conclusion from the given data should be determined.

Concept Introduction:

The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.

Expert Solution & Answer

Answer to Problem 1P

No, we cannot reach an unambiguous conclusion.

Explanation of Solution

Given:

Partial amino acid sequence of the protein:

…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…

To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.

Now, we look for the stop codons: UGA, UAG or UAA.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.

More information is required to find out which is the correct reading frame.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

The beta-lactamase hydrolyzes the lactam-ring in penicillin. Describe the mechanism of hydrolysis, insuring to include the involvement of S, D, & K in the reaction sequence. Please help

To map the active site of beta-lactamase, the enzyme was hydrolyzed with trypsin to yield a hexapeptide (P1) with the following amino acids. Glu, Lys, Leu, Phe, Met, and Ser. Treatment of P1 with phenyl isothiocyanate yielded a PTH derivative of phenylalanine and a peptide (P2). Treatment of P1 with cyanogenbromide gave an acidic tetrapeptide (P3) and a dipeptide (P4).Treatment of P2 with 1-fluoro-2,4-dinitrobenzene, followed by complete hydrolysis, yields N-2,4-dinitrophenyl-Glu. P1, P2, and P3 contain the active site serine. Why doesn't D in this hexapeptide not participate in the hydrolysis of the beta-lactam ring even though S, K, and D are involved in the catalyst?

To map the active site of -lactamase, the enzyme was hydrolyzed with trypsin to yield a hexapeptide (P1) with the following amino acids. Glu, Lys, Leu, Phe, Met, and Ser. Treatment of P1 with phenyl isothiocyanate yielded a PTH derivative of phenylalanine and a peptide (P2). Treatment of P1 with cyanogenbromide gave an acidic tetrapeptide (P3) and a dipeptide (P4).Treatment of P2 with 1-fluoro-2,4-dinitrobenzene, followed by complete hydrolysis, yields N-2,4-dinitrophenyl-Glu. P1, P2, and P3 contain the active site serine. Using the experimental results described above derive the primary sequence of the active site hexapeptide. Please help!

Answer 2

Question

Chapter 30, Problem 1P

Interpretation Introduction

Interpretation:

Whether one can reach an unambiguous conclusion from the given data should be determined.

Concept Introduction:

The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.

Expert Solution & Answer

Answer to Problem 1P

No, we cannot reach an unambiguous conclusion.

Explanation of Solution

Given:

Partial amino acid sequence of the protein:

…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…

To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.

Now, we look for the stop codons: UGA, UAG or UAA.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.

More information is required to find out which is the correct reading frame.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 30, Problem 1P

Interpretation Introduction

Interpretation:

Whether one can reach an unambiguous conclusion from the given data should be determined.

Concept Introduction:

The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.

Expert Solution & Answer

Answer to Problem 1P

No, we cannot reach an unambiguous conclusion.

Explanation of Solution

Given:

Partial amino acid sequence of the protein:

…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…

To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.

Now, we look for the stop codons: UGA, UAG or UAA.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.

More information is required to find out which is the correct reading frame.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 30, Problem 1P

Interpretation Introduction

Interpretation:

Whether one can reach an unambiguous conclusion from the given data should be determined.

Concept Introduction:

The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.

Expert Solution & Answer

Answer to Problem 1P

No, we cannot reach an unambiguous conclusion.

Explanation of Solution

Given:

Partial amino acid sequence of the protein:

…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…

To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.

Now, we look for the stop codons: UGA, UAG or UAA.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.

More information is required to find out which is the correct reading frame.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 30, Problem 1P

Interpretation Introduction

Interpretation:

Whether one can reach an unambiguous conclusion from the given data should be determined.

Concept Introduction:

The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.

Expert Solution & Answer

Answer to Problem 1P

No, we cannot reach an unambiguous conclusion.

Explanation of Solution

Given:

Partial amino acid sequence of the protein:

…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…

To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.

Now, we look for the stop codons: UGA, UAG or UAA.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.

More information is required to find out which is the correct reading frame.

Answer 6

Chapter 30, Problem 1P

Interpretation Introduction

Interpretation:

Whether one can reach an unambiguous conclusion from the given data should be determined.

Concept Introduction:

The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.

Expert Solution & Answer

Answer to Problem 1P

No, we cannot reach an unambiguous conclusion.

Explanation of Solution

Given:

Partial amino acid sequence of the protein:

…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…

To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.

Now, we look for the stop codons: UGA, UAG or UAA.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.

More information is required to find out which is the correct reading frame.

Answer 7

Chapter 30, Problem 1P

Interpretation Introduction

Interpretation:

Whether one can reach an unambiguous conclusion from the given data should be determined.

Concept Introduction:

The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.

Answer 8

Expert Solution & Answer

Answer to Problem 1P

No, we cannot reach an unambiguous conclusion.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Explanation of Solution

Given:

Partial amino acid sequence of the protein:

…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…

To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.

Now, we look for the stop codons: UGA, UAG or UAA.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.

More information is required to find out which is the correct reading frame.

Answer 12

Ch. 30 - Prob. 1P Ch. 30 - Prob. 2P Ch. 30 - The Second Genetic Code Review the evidence...Ch. 30 - Codon-Anticodon Recognition: Base-Pairing...Ch. 30 - Consequences of the Wobble Hypothesis Point out...Ch. 30 - Prob. 6P Ch. 30 - Prob. 7P Ch. 30 - Prob. 8P Ch. 30 - Prob. 9P Ch. 30 - The Consequences of Ribosome Complexity Eukaryotic...

Concept explainers

Videos

Answer to Problem 1P

Explanation of Solution

Want to see more full solutions like this?

Chapter 30 Solutions