Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 30, Problem 13P
Interpretation Introduction
Interpretation:
The Shine-Dalgarno sequence and its role in the variation of the efficiency of initiation of the protein synthesis needs to be defined.
Concept Introduction:
Australian scientists Lynn Dalgarno and John Shine proposed the Shine-Dalgarno sequence. Usually situated 8 bases upstream of the initial codon AUG, it is the ribosomal binding site within the mRNA. This sequence is present both within archaea, as well as in bacteria, and exists in some mitochondrial and chloroplastic transcripts. The sequence of RNA supports recruiting the ribosome towards the mRNA to start protein synthesis via aligning the ribosome with the initial codon.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Given this mRNA strand: 3’ - AUGAGGAAGGUA - 5’; what are the components of the polypeptide?
What will be the overall anti-codon sequence in tRNA for this mRNA?
5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
The sequence below shows the non-coding strand from the
whole of the transcribed region of a very short gene.
5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’
Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).
Chapter 30 Solutions
Biochemistry
Ch. 30 - Prob. 1PCh. 30 - Prob. 2PCh. 30 - The Second Genetic Code Review the evidence...Ch. 30 - Codon-Anticodon Recognition: Base-Pairing...Ch. 30 - Consequences of the Wobble Hypothesis Point out...Ch. 30 - Prob. 6PCh. 30 - Prob. 7PCh. 30 - Prob. 8PCh. 30 - Prob. 9PCh. 30 - The Consequences of Ribosome Complexity Eukaryotic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bparrow_forwardOxytocin is a small peptide hormone. It contains a nine amino acid sequence shown below: CYIQNCPLG 33 How many nucleotides would be found in the mRNA for this protein? Suggest an mRNA sequence for the peptide. Write in as 5' XXX 3' (no spaces between nucleotides). Keep in mind, for a protein to be synthesized it needs to include a start codon and a stop codon. Suggest a complementary template DNA sequence based on the MRNA sequences suggested above. Write in as 3' XXX 5' (no spaces between nucleotides).arrow_forwardThe mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?arrow_forward
- Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5'-GGCCCUUUUACCCGGUUUU-3' 5'-GCAUCUUACUGAUGCUUUU-3' a stem-loop hairpin structure followed by a sequence of uracil residues in the RNA a palindromic region followed by a sequence of adenine residues in the RNA a sequence of uracil-adenine RNA-DNA base pairsarrow_forward10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anarrow_forwardConsider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part 1 of 5 What amino acid sequence is coded for by this mRNA? Leu-Thr-Asp Part 2 of 5 What is the amino acid sequence if a mutation converts UUG to UUA? Leu-Thr-Asp Part 3 of 5 What is the amino acid sequence if a mutation converts ACC to AGC? Leu-Ser-Asp Part: 3/5 Part 4 of 5 What is the amino acid sequence if a mutation converts GAC to CACTarrow_forward
- Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part 1 of 5 What amino acid sequence is coded for by this mRNA? Leu-Thr-Asp Part 2 of 5 What is the amino acid sequence if a mutation converts UUG to UUA? Leu-Thr-Asp Part 3 of 5 What is the amino acid sequence if a mutation converts ACC to AGC? Leu-Ser-Asp Part 4 of 5 What is the amino acid sequence if a mutation converts GAC to CACT Leu-Thr-His Part: 4/5 Part 5 of 5 What is the amino acid sequence if G is added to the beginning of the chain? x Sarrow_forwardA fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.arrow_forward3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand in mRNA. Label the 5’ and 3’ ends. Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.arrow_forward
- An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding protein sequencearrow_forwardAn mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the sequence to give it a missense mutation. Circle/highlight the mutation. Explain how your specific mutation would affect the formation and structure of the 2nd (middle) Base of a Codon 1st U CA G 3rd Base Base UUU Phe UUC Phe UUA Leu UUG Leu UCU Phe UCC Phe UCA Leu UCG Leu UAU Tyr UAC Tyr UAA STOP UAG STOP UGU Cys UGC Cys UGA STOP UGG Trp protein. U CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro ССС Pro CCA Pro CCG Pro CAU His CAC His CAA Gln CAG Gln CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg AAU Asn AAC Asn AUU lle AUC lle AUA lle AUG Met ACU Thr ACC Thr ACA Thr ACG Thr A AAA Lys AAG Lys GUU Val GUC Val GUA Val GUG Val GCU Ala GCC Ala GCA Ala GCG Ala GAU Asp GAC Asp GAA Glu GAG Glu GGU Gly GGC Gly GGA Gly GGG Gly UCAGarrow_forwardConsider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY