Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 30, Problem 8P
Interpretation Introduction
Interpretation:
The reason behind assuming that the synthesis of eukaryotic protein is only 10 % as fast as the synthesis of bacterial protein should be determined.
Concept Introduction:
Transcription is a method of taking the info from DNA, and making RNA. RNA behaves as a go-between for proteins and DNA. The RNA then moves to a part of the cell known as a ribosome. Ribosomes are protein-making factories found in all cells, from humans to bacteria.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Pissssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of
protein synthesis of a eukaryotic cell using the nitrogen bases of the given DNA strand. Include
the following terms in your description (1 paragraph pls):
-DNA
- mRNA
-protein
-tRNA
-Amino acid
-codon
-nucleus
-Ribosome
-cytoplasm
-transcription
-translation
Hi, Can someone solve this question, what are the steps of translation in order based on when they occur?
It would be nice if some solved it
Plssssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic cell using the nitrogen bases of the given DNA strand. Include the following terms in your description:
-DNA
- mRNA
-protein
-tRNA
-Amino acid
-codon
-nucleus
-Ribosome
-cytoplasm
-transcription
-translation
Chapter 30 Solutions
Biochemistry
Ch. 30 - Prob. 1PCh. 30 - Prob. 2PCh. 30 - The Second Genetic Code Review the evidence...Ch. 30 - Codon-Anticodon Recognition: Base-Pairing...Ch. 30 - Consequences of the Wobble Hypothesis Point out...Ch. 30 - Prob. 6PCh. 30 - Prob. 7PCh. 30 - Prob. 8PCh. 30 - Prob. 9PCh. 30 - The Consequences of Ribosome Complexity Eukaryotic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- 10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anarrow_forwardAnalyse and interpret the SCAM data in Fig. 1, and make a table (remember to include a legend) to indicate where each amino acid is located (cytoplasm, membrane, periplasm).arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
- The dimensions of prokaryotic ribosomes are approximately 14 nm by 20 nm. If ribosomes occupy 20% of the volume of a bacterial cell, calculate how many ribosomes are in a typical cell as E. coli. Assume that the shape of a ribosome is approximately that of a cylinder.arrow_forwardAs described in the figure below, the technique of ultracentrifugation can be used to demonstrate whether a substance is composed of large covalently linked molecules, or smaller molecules held together in a complex by noncovalent bonds. You are studying two substances that both have very high molecular weights: hyaluronan, a carbohydrate found in the extracellular matrix with a MW of ~8 x 106 daltons, and the bacterial ribosome, with a MW of -2.5 x 106. Hyaluronan is a single, long-chain polymer, while the ribosome subunit is a complex of 55 different proteins plus three long RNA molecules. Which of the following describes the pattern you would expect to see from ultracentrifugation of these two substances? the sample loaded as a narrow band at the top of the tube (A) sample CENTRIFUGATION stabilizing sucrose gradient tube heterogeneous aggregates would sediment to produce a diffuse smear hemoglobin protein sediments as a single bandarrow_forwardWhat is Protein folding? Give at least 3 diseases that results from protein misfolding. Explain each. Can you give me a brief explanation about this question? Not less than 3 sentences.arrow_forward
- Are these true or false answers correct? If so, what is the proper word to replace the underlined words, for the false.arrow_forwardNonearrow_forwardEukaryotic ribosomes (choose all that apply) Select one or more answers and submit. For keyboard navigation... SHOW MORE ✓ a b C d e Multiple answers: Multiple answers are accepted for this question f are composed of a large subunit and a small subunit. are composed of a single RNA are composed of a single protein. are composed of multiple RNAs and multiple proteins. are always found in a constant number in a growing dividing cell. fluctuate in numbers based on the needs of the cell.arrow_forward
- I need an example to study for an testarrow_forwardOn average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.arrow_forwardDNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY