Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 30, Problem 12P
Interpretation Introduction
Interpretation:
The method of identifying whether a methionyl-tRNA initiates the synthesis of protein or delivers a Met residue to incorporate in the polypeptide chain by bacterial cells needs to be determined. The difference in the Met codon for the two purposes needs to be explained. The role of eukaryotic cells in handling such problems needs to be explained.
Concept Introduction:
The polypeptide chains are formed from the amino acids joining together by peptide bonds. The proteins are known to be
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
helpp, if u could do this one first please
Match the following (Most appropriate combinations only):
IF1
IF3
IRES
Shine-Dalgarno sequence
m7-G Cap
aminoacyl tRNA synthetase proofreading
elF4E
[Choose ]
Binds ribosome A site
Translation initiation in eukaryotes
Translation initiation in Bacteria
binds mRNA cap in eukaryotes
Binds ribosome E site
Correct charging of a tRNA with amino acid
Cap-independent translation initiation of some viral mRNAs
[Choose ]
[Choose ]
[Choose ]
[Choose ]
In the absence of cladosporin, explain the elongation steps in the synthesis of lysyl-tRNA synthetase enzyme or protein in bacterial cells by including any elongation factors, base pairing of codon/anticodon, any conformational shift, proofreading, any hydrolysis, exchange, ribosomal subunits involved, charged tRNA, peptide bond formed.
This question does not require a super long in depth answer, a short to the point answer is preferred if possible. Thank you!
Chapter 30 Solutions
Biochemistry
Ch. 30 - Prob. 1PCh. 30 - Prob. 2PCh. 30 - The Second Genetic Code Review the evidence...Ch. 30 - Codon-Anticodon Recognition: Base-Pairing...Ch. 30 - Consequences of the Wobble Hypothesis Point out...Ch. 30 - Prob. 6PCh. 30 - Prob. 7PCh. 30 - Prob. 8PCh. 30 - Prob. 9PCh. 30 - The Consequences of Ribosome Complexity Eukaryotic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- 4arrow_forwardFor the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.arrow_forwardWhat are the functional consequences of this deletion for lilP mRNA transcription and translation? (100 words max.)arrow_forward
- Explain the interactions of specific tRNA with its synthetase, by including the importance of cloverleaf structure of tRNA, which domains are involved, distinct recognition sites, D-arm, TψC arm, anticodon loop and stem, linkage, activation, amino acceptor arm, ensuring the correct tRNA to be recognized by its synthetase. Please do not answer with an incredibly long reply. I would just like the most condensed answer possible by providing all key points asked about. Thanks!arrow_forwardNonearrow_forwardIn Figure 9-12(b), what do you think happens to thetRNA that is released from the E site?arrow_forward
- Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.arrow_forwardPlease determine the order of aminoacids from a given genetic code? 5’-UGGUACGGUACUCCAC-3’arrow_forwardReferring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′arrow_forward
- question in image, thank you!arrow_forwardEF-Tu binds all aminoacyl–tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same effi ciency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl–tRNAs (see table), explain how the tRNA–EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.arrow_forwardA random-sequence polyribonudeotide produced by polynudleotide phosphorylase, with CDP and ADP in a 5:1 molar ratio stimulated the incorporation of proline, histidine, threonine, glutamine, asparagine, and ly- sine in a cell-free translation system in the following proportions: 100, 23.4, 20, 3.3, 3.3, and 1.0, respectively. What does this experiment reveal about the nucleotide composition of coding triplets for these six amino acids?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY