Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 29P
If you were to compare your genome sequence with that of your parents, how would it differ? If you were to compare your genome sequence with another student’s in the class, how would it differ? What additional differencemight you see if your genome was compared with that of asub-Saharan African, or if you are of sub-Saharan Africandescent, with that of a non-African?
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
How much of the human genomesequence is functional, and why is theremainder retained?
A scientist investigating the genome of two related individuals observes a difference of a few nucleotides in one individual compared to the other. The nucleotide differences are
in a region of noncoding DNA on chromosome 1. Would these differences be considered a mutation? Why or why not?
Yes, the difference in nucleotide sequences between the individuals is a mutation because it will affect the phenotype of the two individuals.
Yes, any heritable variation in the nucleotide sequence is considered a mutation, even if that variation is in a noncoding region of DNA.
Not enough information was provided to determine if this nucleotide difference is a mutation because the effect on phenotype is unknown.
No, the change in nucleotide sequence doesn't appear in a coding region of the DNA and so can't be a mutation.
What does the future hold for genomes? How will they be different in 100, 1,000, 1 million, or 1 billion years? Make this a long discussion.
Chapter 18 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 18 - You have discovered a new species of Archaea from...Ch. 18 - 16.2 Repetitive DNA poses problems for genome...Ch. 18 - 16.3 When the whole-genome shotgun sequence of the...Ch. 18 - How do cDNA sequences facilitate gene annotation?...Ch. 18 - 16.5 How do comparisons between genomes of related...Ch. 18 - 16.6 You are designing algorithms for the...Ch. 18 - 16.7 You have sequenced a region of the Bacillus...Ch. 18 - You have just obtained 100-kb of genomic sequence...Ch. 18 - 16.9 The human genome contains a large number of...Ch. 18 - Based on the tree of life in Figure 16.12, would...
Ch. 18 - 16.11 When comparing genes from two sequenced...Ch. 18 - Prob. 12PCh. 18 - Prob. 13PCh. 18 - Prob. 14PCh. 18 - 16.16 Consider the phylogenetic tree below with...Ch. 18 - You have isolated a gene that is important for the...Ch. 18 - 16.18 When the human genome is examined, the...Ch. 18 - Symbiodinium minutum is a dinoflagellate with a...Ch. 18 - Substantial fractions of the genomes of many...Ch. 18 - 16.21 A modification of the system, called the ...Ch. 18 - 16.22 A substantial fraction of almost every...Ch. 18 - 16.23 In the globin gene family shown in Figure ,...Ch. 18 - You are studying similarities and differences in...Ch. 18 - In conducting the study described in Problem 24,...Ch. 18 - Prob. 26PCh. 18 - Prob. 27PCh. 18 - Prob. 28PCh. 18 - If you were to compare your genome sequence with...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Would you expect the genome of the macaque(a monkey) to be more like that of a mouse or thatof a human? Explain.arrow_forwardIf you compare the frequency of the sixteen pos-sible dinucleotide sequences in the E. coli and humangenomes, there are no striking differences except for onedinucleotide, 5ʹ-CG-3ʹ. The frequency of CG dinucleotidesin the human genome is significantly lower than in E. coliand significantly lower than expected by chance. Why doyou suppose that CG dinucleotides are underrepresentedin the human genome?arrow_forwardGiven our knowledge of genome sizes in different organisms, would you predict that Homo sapiens or the two-toed salamander (Amphiuma means) has the larger genome?arrow_forward
- A particular disease is found in a group of South AmericanIndians. During the 1920s, many of these people migrated toCentral America. In the Central American group, the diseaseis never found. Discuss whether or not you think the diseasehas a genetic component. What types of further observationswould you make?arrow_forwardWhat is the difference between the core genome and pan genome? Why might your infer if you compare two genera one is in which the size of the core genome and pan genome are very similar and one is which the core genom is must smaller than the pan genome?arrow_forward. In 2015, an international team of scientists assembledthe complete genome sequences of two differentwoolly mammoths. Both specimens were discoveredburied in the permafrost of Siberia, the coldest inhabited place on earth. Through radiocarbon dating, itwas determined that one of the mammoths, found onWrangel Island off the Siberian coast, died about4000 years ago; the other mammoth, found in thetown of Oimyakon, died about 45,000 years ago.Analysis revealed that the genome sequences ofthese two animals differed significantly in the distribution of base pairs at which they are either homozygous or heterozygous. The Wrangel Island woollymammoth had an extreme excess of runs of homozygosity (ROHs), regions in which the animal was homozygous for all of the base pairs. About 23.4% ofthe Wrangel Island animal’s genome was composed ofROHs that were greater than 500 kb in length; someof these ROHs were in excess of 5 Mb long. In contrast, only 0.83% of the Oimyakon animal’s genomeconsisted of…arrow_forward
- how can genomes with a relatively small number of genes produce the vast complexity of phenotypes that results in living organisms, including humans?arrow_forward1) What do you want to learn, if anything, about your own genome? Answer: Honestly i am not a biological son of my parents therefore i am an adopted child, so what comes in my mind of knowing my own genome is to know about Genetic and biochemical disorder of my real parents or ancestors if there is any. Is my answer correct? if not, please make it correctarrow_forwardThe picturearrow_forward
- What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forwardThe following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.arrow_forwardWhat is the smallest genome?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License