If you compare the frequency of the sixteen pos-sible dinucleotide sequences in the E. coli and humangenomes, there are no striking differences except for onedinucleotide, 5ʹ-CG-3ʹ. The frequency of CG dinucleotidesin the human genome is significantly lower than in E. coliand significantly lower than expected by chance. Why doyou suppose that CG dinucleotides are underrepresentedin the human genome?

Q: the TPOX allele with the structure [TAGA]10 will be ______ nucleotides longer than the allele with…

A: [TAGA]10  will have four nucleotides longer than the allele with the structure [TAGA]5

Q: What would be the expected distribution of centrifuged DNA (in the Meselson /Stahl experiment),…

A: Using E. coli bacteria as a model system Meselson and Stahl conducted experiments on DNA replication…

Q: Let’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the…

A: Sequence assembly involves the alignment and merging of fragments from a DNA (deoxyribonucleic acid)…

Q: During your experiment you analysed only a few of the recombinant clones for the presence of…

A: The objective of the question is to understand how to construct a probe for nucleic acid…

Q: For each of the restriction enzymes listed below:(i) Approximately how many restriction…

A: Hello there! As you have posted multiple questions, we are answering only the first sub-part…

Q: Design PCR primers for the DNA sequence given below and explain your choice. As part of your answer,…

A: It is a Polymerase Chain Reaction, which is a mechanism for multiplying a specific piece of DNA…

Q: When Meselson and Stahl grew E. coli in 15N mediumfor many generations and then transferred the…

A: Earlier, it was proposed that DNA replication in an organism could occur in three ways following the…

Q: Fig 3.16 EcoRI SacI Kpnl ampR Aval Xmal Smal lacZ BamHI Xbal Sall AccI HincII PstI Sphl HindIII Bam…

A: A bacterial protein termed restriction enzyme, also known as molecular scissors, cleaves DNA at…

Q: what would be the expected distribution of DNA by the fourth (F4) generation?

A: Ans. The mechanism of DNA replication in all known cells is represented by semi-conservative…

Q: What would be the expected distribution of centrifuged DNA (in the Meselson /Stahl experiment),…

A: Meselson and Stahl experiment The experiment carried out by Meselson and Stahl tells us about nature…

Q: Would you expect the genome of the macaque(a monkey) to be more like that of a mouse or thatof a…

A: The genome is the complete set of genes in the DNA of an organism. DNA sequence carries the coding…

Q: Assuming human cells have on average 1000 mitochondria, what percentage by weight of the total…

A: The mitochondrial DNA (deoxyribonucleic acid) is 16.6 kilobase pair long that contains 37 genes. It…

Q: Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport…

A: There are basically two main types of gene transfer - Vertical gene transfer and Horizontal gene…

Q: Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport…

A: Genes are the functional units of DNA and express a functional protein. They are made up of…

Q: Shown below are eight DNA sequences from different individuals QGive the nucleotide positions of all…

A: SNPs or single nucleotide polymorphisms are due to the substitution of a single nucleotide that…

Q: Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements…

A: The transposable elements are sequences which keeps on changing their position in the human genome,…

Q: A The above experiment, on DNA replication in the intact chromosomes of E. coli (with no virus…

A: 1. If the intact chromosomes of E.Coli are labeled with heavy nitrogen (15N), then is fed light…

Q: In a sequence encompassing 99.4 percent of theeuchromatic regions of human chromosome 1, Gregoryet…

A: Characteristics of genomics are: 1) Spontaneous mutations or accumulate mutants caused by physical…

Q: 1. There are two different variations at STR locus THO1. Where did these variations come from? b)…

A: The variations at STR locus THO1 come from the inheritance of alleles from the individual's parents.…

Q: The consensus sequence of the protospacer adjacent motif (PAM) sequence in bacterial strain A is…

A: For Cas9 to work, it additionally requires a particular protospacer adjacent motif (PAM) that…

Q: Four cosmid clones, which we will call cosmids A, B, C, and D, werehybridized to each other in…

A: A plasmid is a small, extrachromosomal DNA molecule within a cell that is physically separated from…

Q: In a transformation experiment, donor DNA was obtained from aprototroph bacterial strain (a+b+c+),…

A: In the given question, Donor= a+b+c+ Recipient = a-b-c- A donor genotype is transformed into…

Q: DNA containing the genes gin+ phe+ lys+ was used to transform bacterial cells of genotype gln- phe-…

A: As per the question :-  Genotypes and number of individuals obtained are as:-  A ) gly + phe+ lys +…

Q: You know from your calculationsthat only a small proportion of the human genome is represented, even…

A: The objective of the question is to outline a strategy for constructing a genomic DNA library that…

Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…

A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…

Q: Using the conventions of Figure 4-15, draw parents andprogeny classes from a crossP M′′′/p M′ × p…

A: Polymerase chain reaction (PCR) is a process frequently used to swiftly create millions to billions…

Q: Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon…

A: DNA provides mutagenic bases hypoxanthine and uracil when deaminated by adenine and cytosine…

Q: Which RE can be used to distinguish bacterial strain 1 from strain 2 based on a sample DNA fragment…

A: Restriction enzymes are a type of nuclease that cuts DNA at a specific sequence of nucleotides. They…

Q: After treating cells with a chemical mutagen, youisolate two mutants. One carries alanine and the…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: are using the restriction enzyme HAEIII to digest different samples of the taster gene isolated from…

A: In gel electrophoresis DNA to be tested is broken down by various restriction endonucleases into…

Q: If you compare the frequency of the sixteen possible dinucleotide sequences in the E. coli and human…

A: CG directly activates pDCs and B cells. The resultant immune response is characterized by the…

Q: In addition to correcting DNA mismatches, themismatch repair system functions to prevent…

A: Mutations are usually defined that they are supped to refer to changes or alterations that occur in…

Q: In the genome of Zea mays, in the segment 120M to 120,030k of Chromosome 5, what repeat elements do…

A: A monoecious plant has male and female flowers on the same plant, or flowers that have both male and…

Q: Eukaryotic genomes are replete with repetitive sequences that make genome assembly from…

A: Tandem repeats of the dinucleotide sequence are the repetitive sequences that are found at many…

Q: Based on the following graph, the number of base pairs of a fragment of DNA that has migrated 39 mm…

A: A separation technique known as electrophoresis relies on the movement of charged species in a…

Q: Is the formula "genotype + environment=phenotype" accurate?

A: Genotype  It is the contents of genome. Phenotype   It is the physical appearance.

Q: Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport…

A: The mutation is an alteration in the sequence of DNA. Codon is a 3 DNA nucleotide sequence that is…

Q: Would you be more likely to find single nucleotidepolymorphisms (SNPs) in the protein-coding or in…

A: Single nucleotide polymorphisms in short SNPs refer to the variation in a single base pair that…

Q: If the intact chromosomes of E. coli are labeled with heavy nitrogen (15N), then E. coli is fed…

A: This experiment was performed to check whether the DNA model is conservative or semiconservative. A…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.