The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
The sequence of a region of interest in a DNA template strand is
3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxy
sequencing experiment anneals just to the left of this sequence, draw
the sequencing ladder that will be obtained.

DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A), cytosine (C), thymine (T), and guanine (G)] in a DNA sequence. They have a wide variety of applications in the field of medicine, forensics, and agriculture.
Step by step
Solved in 2 steps









