Biochemistry: The Molecular Basis of Life
6th Edition
ISBN: 9780190209896
Author: Trudy McKee, James R. McKee
Publisher: Oxford University Press
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 17, Problem 7Q
Summary Introduction
To review:
The sequence of a complementary strand of given deoxyribonucleic acid (DNA), the sequence of a messengerribonucleicacid (mRNA), and the sequence of antisense RNA species from the given strand: 5’-GCATTCGAATTGCAGACTCCTGCAATTCGGCAAT-3’.
Introduction:
DNAisa double helix molecule. It contains information in two complementary strands. The information is transcribed only when one strand of DNA acts as a template strand for the synthesis of RNA molecules. This template strand is referred to as the anti-sense (noncoding) strand, and the non-transcribed strand is called as the sense (coding) strand.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The code for a fully functional protein is actually coming from an mRNA transcript that has undergone post-transcriptional processing which is essentially way too different from the original code in the DNA template.
Given: GUC-CAC-UUA-ACC-CCU-GAG-GAG-AAA-UCG-GCC (Protein with known amino acid sequence)
Requirement: Original DNA code. Itemize the steps you would take to get to know the original DNA code of the protein in focus.
The code for a fully functional protein is actually coming from an mRNA transcript that has undergone post-transcriptional processing which is essentially way too different from the original code in the DNA template.
Given: Val-His-Leu-Thr-Pro-Glu-Glu (Protein with known amino acid sequence)
Requirement: Original DNA code. Itemize the steps you would take to get to know the original DNA code of the protein in focus.
The code for a fully functional protein is actually coming from an mRNA transcript that has undergone post transcriptional processing which is essentially way too different from the original code in the DNA template.
Given: Cytosine; a Protein with known amino acid sequence
Requirement: Original DNA code (itemize the steps you would take to get to know the original DNA code of Cytosine in focus)
Chapter 17 Solutions
Biochemistry: The Molecular Basis of Life
Ch. 17 - Prob. 1QCh. 17 - Prob. 2QCh. 17 - Prob. 3QCh. 17 - Prob. 4QCh. 17 - Prob. 5QCh. 17 - Prob. 6QCh. 17 - Prob. 7QCh. 17 - Prob. 8QCh. 17 - Prob. 1RQCh. 17 - Prob. 2RQ
Ch. 17 - Prob. 3RQCh. 17 - Prob. 4RQCh. 17 - Prob. 5RQCh. 17 - Prob. 6RQCh. 17 - Prob. 7RQCh. 17 - Prob. 8RQCh. 17 - Prob. 9RQCh. 17 - Prob. 10RQCh. 17 - Prob. 11RQCh. 17 - Prob. 12RQCh. 17 - Prob. 13RQCh. 17 - Prob. 14RQCh. 17 - Prob. 15RQCh. 17 - Prob. 16RQCh. 17 - Prob. 17RQCh. 17 - Prob. 18RQCh. 17 - Prob. 19RQCh. 17 - Prob. 20RQCh. 17 - Prob. 21RQCh. 17 - Prob. 22RQCh. 17 - Prob. 23RQCh. 17 - Prob. 24RQCh. 17 - Prob. 25RQCh. 17 - Prob. 26RQCh. 17 - Prob. 27RQCh. 17 - Prob. 28RQCh. 17 - Prob. 29RQCh. 17 - Prob. 30RQCh. 17 - Prob. 31RQCh. 17 - Prob. 32RQCh. 17 - Prob. 33RQCh. 17 - Prob. 34RQCh. 17 - Prob. 35RQCh. 17 - Prob. 36RQCh. 17 - Prob. 37RQCh. 17 - Prob. 38RQCh. 17 - Prob. 39RQCh. 17 - Prob. 40RQCh. 17 - Prob. 41FBCh. 17 - Prob. 42FBCh. 17 - Prob. 43FBCh. 17 - Prob. 44FBCh. 17 - Prob. 45FBCh. 17 - Prob. 46FBCh. 17 - Prob. 47FBCh. 17 - Prob. 48FBCh. 17 - Prob. 49FBCh. 17 - Prob. 50FBCh. 17 - Prob. 51SACh. 17 - Prob. 52SACh. 17 - Prob. 53SACh. 17 - Prob. 54SACh. 17 - Prob. 55SACh. 17 - Prob. 56TQCh. 17 - Prob. 57TQCh. 17 - Prob. 58TQCh. 17 - Prob. 59TQCh. 17 - Prob. 60TQCh. 17 - Prob. 61TQCh. 17 - Prob. 62TQCh. 17 - Prob. 63TQCh. 17 - Prob. 64TQCh. 17 - Prob. 65TQCh. 17 - Prob. 66TQCh. 17 - Prob. 67TQCh. 17 - Prob. 68TQCh. 17 - Prob. 69TQCh. 17 - Prob. 70TQCh. 17 - Prob. 71TQCh. 17 - Prob. 72TQCh. 17 - Prob. 73TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at the bottom”) of a segment of double helical DNA contains the sequence (5′) TCCGCTCCATCG (3′). What is the base sequence of the mRNA that can be transcribed from this strand?arrow_forwardHere is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that would be transcribed from the bottom strand of the DNA:arrow_forwardThe relaxation of base-paring rules between the TRNA and MRNA is termed as Answer:arrow_forward
- Several different nucleic acids are involved in the process of getting a protein produced from a gene. DNA contains the "genetic code" for the protein. DNA is double-stranded, but only one strand is transcribed into MRNA. The MRNA then goes into the cytoplasm where it is translated into protein with the help of TRNA. At each stage of the process, there is base complementarity (A pairs with T/U and C pairs with G) between the nucleic acids involved to ensure the integrity of the DNA blueprint for the protein being produced. Therefore, some of the four strands of nucleic acids involved will match (except U replaces T in RNA) and some will have base complementarity. Indicate whether there is matching (1) or base complementarity (2) between the following nucleic acids. DNA sense strand and MRNA DNA sense strand and tRNA DNA antisense strand and MRNA MRNA and TRNAarrow_forwardAKS 5c1: The model below represents the process of protein synthesis. What is the best description for what occurs during process A and process B in the model? * AA A GA TIT TT G CITG GCITAG |A AMGAA MAQ IB phenyl- alanine leucine alanine glycine methionineH iysine Process A is showing transcription, which uses a DNA template to create an mRNA copy of the genetic code. Process B is showing translation, which uses the MRNA to create a polypeptide chain. Process A is showing translation, which uses a DNA template to create an MRNA copy of the genetic code. Process B is showing transcription, which uses the MRNA to create a nolynentide chain ATarrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forward
- More than one answer can be correctarrow_forwardYou may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5-AUGCCCAGAGCU-3' Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the encoded protein? O 5-AUGCCCAGGGCC-3' O 5'-AUGCCCUGAGCU-3' O 5'-AUGCCCACAGCU-3 5'-AUGCCCCAGAGCU-3arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forward
- Polypeptides can be reversed back to RNA because of the enzyme transcriptase. The genetic material must be replicated with high fidelity and great speed. Eukaryotic mRNA is said to be polycistronic since they encode multiple polypeptide chains RNA-synthesis occurs inside the nucleus while protein synthesis in the cytoplasm of eukaryotic organisms. Write T if the statement is true and write F if the statement is falsearrow_forwardThe following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.arrow_forwardIn eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA strand. True or false?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License