
Concept explainers
(a)
Interpretation:
Structure of alcohol that is formed when the given compound undergoes reduction with molecular hydrogen and nickel catalyst have to be drawn.
Concept Introduction:
In
In organic chemistry, reduction reaction is referred to the number
Alcohols undergo oxidation reaction and reduction reaction. This depends upon the number of hydrogen atoms that is bonded to the alpha carbon atom. Primary and secondary alcohol undergoes oxidation reaction while tertiary alcohol does not undergo oxidation reaction. Primary alcohols undergo oxidation to give
Aldehyde undergoes oxidation to give carboxylic acid as the product while ketone does not undergo oxidation reaction.
The reverse of
(b)
Interpretation:
Structure of alcohol that is formed when the given compound undergoes reduction with molecular hydrogen and nickel catalyst have to be drawn.
Concept Introduction:
In organic chemistry, oxidation reaction is referred to the number
In organic chemistry, reduction reaction is referred to the number
Alcohols undergo oxidation reaction and reduction reaction. This depends upon the number of hydrogen atoms that is bonded to the alpha carbon atom. Primary and secondary alcohol undergoes oxidation reaction while tertiary alcohol does not undergo oxidation reaction. Primary alcohols undergo oxidation to give aldehyde and carboxylic acid as product. Secondary alcohol undergoes oxidation to give ketone as the product.
Aldehyde undergoes oxidation to give carboxylic acid as the product while ketone does not undergo oxidation reaction.
The reverse of oxidation reaction is reduction reaction. Reduction of aldehyde gives primary alcohol as the product and reduction of ketone gives secondary alcohol as the product. Reduction can be accomplished using hydrogen gas and a metal catalyst namely nickel.
(c)
Interpretation:
Structure of alcohol that is formed when the given compound undergoes reduction with molecular hydrogen and nickel catalyst have to be drawn.
Concept Introduction:
In organic chemistry, oxidation reaction is referred to the number
In organic chemistry, reduction reaction is referred to the number
Alcohols undergo oxidation reaction and reduction reaction. This depends upon the number of hydrogen atoms that is bonded to the alpha carbon atom. Primary and secondary alcohol undergoes oxidation reaction while tertiary alcohol does not undergo oxidation reaction. Primary alcohols undergo oxidation to give aldehyde and carboxylic acid as product. Secondary alcohol undergoes oxidation to give ketone as the product.
Aldehyde undergoes oxidation to give carboxylic acid as the product while ketone does not undergo oxidation reaction.
The reverse of oxidation reaction is reduction reaction. Reduction of aldehyde gives primary alcohol as the product and reduction of ketone gives secondary alcohol as the product. Reduction can be accomplished using hydrogen gas and a metal catalyst namely nickel.
(d)
Interpretation:
Structure of alcohol that is formed when the given compound undergoes reduction with molecular hydrogen and nickel catalyst have to be drawn.
Concept Introduction:
In organic chemistry, oxidation reaction is referred to the number
In organic chemistry, reduction reaction is referred to the number
Alcohols undergo oxidation reaction and reduction reaction. This depends upon the number of hydrogen atoms that is bonded to the alpha carbon atom. Primary and secondary alcohol undergoes oxidation reaction while tertiary alcohol does not undergo oxidation reaction. Primary alcohols undergo oxidation to give aldehyde and carboxylic acid as product. Secondary alcohol undergoes oxidation to give ketone as the product.
Aldehyde undergoes oxidation to give carboxylic acid as the product while ketone does not undergo oxidation reaction.
The reverse of oxidation reaction is reduction reaction. Reduction of aldehyde gives primary alcohol as the product and reduction of ketone gives secondary alcohol as the product. Reduction can be accomplished using hydrogen gas and a metal catalyst namely nickel.

Want to see the full answer?
Check out a sample textbook solution
Chapter 15 Solutions
Study Guide with Selected Solutions for Stoker's General, Organic, and Biological Chemistry, 7th
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage

