You made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -35 region -10 region TATAAT Consensus sequence TTGACA Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100 0 B-Galactosidase activity Mutant 1 Wild-type Lac promoter Mutant 2 Mutant 3 Mutant 4 No promoter

Q: The sequence of the lac promoter and two mutant promoters (Mutn 1 and Mutn 2) are shown below. The…

A: Transcription - Transcription refers to the process by which genetic information encoded in DNA is…

Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…

A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: The data below depicts the binding of the E coli RNA Polymerase to DNA containing a promoter…

A: RNA polymerase is specific enzyme that synthesized RNA from the strand of DNA. They helps to copying…

Q: Propose a final method of gene regulation of the Up Lateoperon using an updated drawn figure of the…

A: An operon is a part of the DNA where a few genes are clustered together that are transcribed…

Q: Some prion-related diseases, such as familial fatal insomnia, areinherited. How would you expect the…

A: Familial fatal insomnia is a medical condition characterized by insomnia or trouble sleeping. This…

Q: What is a consensus sequence? How similar to the consensus sequence would you expect the promoter of…

A: Introduction  An area of DNA upstream of a gene called a promoter, as it relates to genomics, is…

Q: What would be the consequences of inserting 10 random base pairs immediately downstream of the -10…

A: Transcription is a localized process. Only the portion of the DNA that is associated with the gene…

Q: Wild-type E. coli grow best at 37oC, but can grow efficiently at temperatures up to 42oC. An E. coli…

A: Mutations is the phenomenon in which small changes in the nucleotide sequences takes place which…

Q: A graduate student is trying to create a more efficient in vitro transcription system. The students…

A: The sigma factor is essential for identifying and attaching to particular promoter sequences, which…

Q: Suppose you want to study the transcription in vitro of one particular gene in a DNA molecule that…

A: Transcription is the first step in gene expression during which the nucleotide sequence of DNA is…

Q: You identify a new transcriptional regulator that binds a known sequence of DNA. You are able to…

A: Identify a new transcriptional regulator that binds a known sequence of DNA.Observe the behavior of…

Q: None

A: Here is the matching of each aspect of transcription or translation with the appropriate motif,…

Q: You are working with a laboratory strain of E.coli that contains a 10 base-pair deletion in the Lac…

A: The lac operator is the negative regulatory site in the lac operon of E.coli. Here the repressor…

Q: c) You use chromatin immunoprecipitation to measure the location and amount of transcription factors…

A: Transcription factors are protein molecules which bind to specific DNA sequences to regulate gene…

Q: Consider a gene being transcribed at a constant rate k1 and being degraded with first  order…

A: The genetic information from protein synthesis is stored in DNA. This information is copied onto an…

Q: You have isolated a mutant that you call Mutant Z. In a Mutant Z strain, the RNA polymerase can bind…

A: Here, the correct answer is option c) domain 2 of sigma and d) 3/4 linker of sigma.

Q: Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are…

A: In prokaryotes, the process of transcription and translation occur simultaneously due to the lack of…

Q: Explain how a transcriptional fusion to a reporter gene, combined with site directed mutagenesis,…

A: Studies of gene expression and promoter activity are frequently made easier with the aid of gene…

Q: Mutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter…

A: In bacterial promoters, the sequence of the -10 site is critical for binding of RNA polymerase and…

Q: What is the meaning of the term consensus sequence? Give an example. Describe the locations of…

A: The consensus sequences are widely used in molecular biology. The genes are controlled by the…

Q: In bacteria, genes that are often used together are controlled by a single promoter. Explain why…

A: Gene regulation refers to the numerous processes that regulate which genes are expressed and the…

Q: al4 is a transcription factor that activates transcription of galactose metabolism genes in yeast.…

A: Glycolysis is a primary source of energy in yeast, and glucose is by far the most favored carbon…

Q: Identify the DNA elements and protein factors, #1- 7, in the figure below that are involved in the…

A: Central Dogma =  According to the central DNA is converted to RNA (transcription) and RNA to protein…

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.