You are studying tumor cells excised from a patient with suspected Colorectal cancer and you will like to evaluate the status of the DNA repair mechanisms in the tissues. Which of these will be helpful in estimating the functional status of the DNA repair mechanisms in this tissue? Group of answer choices Monoubiquitinated FANCD2 protein PhosphorylatedDNA-PK DNA-damage induced foci All of these

Q: Please answer fast Give ans for each statement   1.A protein linked to a disease state is being…

A: A protein cause disease if it misfolded and aggregared even though it has same amino acid…

Q: d. What does ‘transfection’ mean? e. What are ‘single clones’ and how did various single clones…

A: de novo DNA methylation is the addition of methyl groups to specific sites in the promoter region of…

Q: A deletion mutation occuring in the region of DNA which encodes for a sigma subunit of RNA…

A: Mutation is sudden, heritable change in the sequence of the genome that give rise to alternate form…

Q: Capacity to carry oxygen by sickle cell hemoglobin is reduced due to

A: Sickle cell disease is a group of disorders of blood generally inherited from  parents to their…

Q: Which of these pairs of clinical applications of DNA repair mechanisms is not accurate? Group of…

A: To correct the DNA damage within cells, the cell uses various cellular repair mechanisms called DNA…

Q: Briefly, be able to define each of these AND, where relevant, tell what do they do, and which…

A: As per our guideline we are allowed to answer only starting three.  Please repost the other.

Q: Why might some cells in the body, such as those in bonemarrow, be more susceptible to ribosomal…

A: Mutation It is the sudden heritable changes happening in the genotype of the organism which is…

Q: Using figure (a) above as guide, list the five components in the CRISPR-Cas9 bacterial defense…

A: CRISPR is a acronym for Clustered regularly interspaced short palindromic repeats. It forms a very…

Q: The Cystic Fibrosis receptor (CFTR) is a transmembrane protein that functions as an ion channel…

A: The compartment where Delta 508 mutation occurs that leads to folding defect in CFTR.  This causes a…

Q: In chemotherapy, what are the mechanism of action of cisplatin and alkylating agents.  Why are these…

A: Chemotherapy is a medication treatment that employs the use of potent chemicals to kill rapidly…

Q: a deaminating agent 5-BU is that can base-pair ike cytosine or like if 5-BU is cytosine incorporated…

A: 5-Bromo Uracil and nitrous acid are mutagenic agents. It means both of these agents cause mutation…

Q: Also answer Location number where correspond the 3 end of mRNA from this gene ans where u would find…

A: Exons are nucleic acid coding sequences that can be found in mRNA. Non-coding segments in DNA are…

Q: EUKARYOTIC RNA POLYMERASES Based on their elution order from ion-exchange chromatography…

A: Eukaryotic RNA polymerase :  In eukaryotic cells we can find three different types of RNA…

Q: Would the cell likely experience an issue due to the incorrect function of the protein produced by…

A: DNA ( deoxyribonucleic and) is a genetic material in most of the organism that appear as two…

Q: Based on the sensitivity of DNA to DNase I, as illustrated in Figure , which type of chicken…

A: Deoxyribonucleic acid (DNA) is the genetic material of the most of the organisms that carry coded…

Q: 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP…

A: Transcription is the process of formation of mRNA from DNA template strands by an enzyme called RNA…

Q: Which outcome most likely results from exposure of Ogg1 mice to TNFa O A. Increase in cancer…

A: DNA and RNA are biomolecules that carry genetic information between different generations of cells.…

Q: Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this…

A: Duchenne muscular dystrophy is a disease charecterised by muscular weakness due to lack of a protein…

Q: Ultraviolet light causes thymine dimers to form in DNA. Some individuals are genetically incapable…

A: Genetic variation is very important for evolution, but genetic stability is crucial for survival…

Q: Which of the following is false regarding DNA repair mechanisms? DNA ligase is needed to establish…

A: DNA repair is a process by which a cell identifies and corrects damage to the DNA molecules. Most…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some…

A: Within the living cells, various proteins play an important role in function by binding to the DNA.…

Q: How has the mutation altered the polypeptide? Is the function of the hemoglobin molecule (which…

A: Sickle cell disease is a blood disorder characterized by sickle shaped RBCs which has got less…

Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…

A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…

Q: How many of the mutations listed below would lead to excessive cell growth when the cell was either…

A: Excessive growth occurs when a cell continuously divides and when there is no cell cycle arrest. Myc…

Q: Based on the sensitivity of DNA to DNase I, as illustrated in Figure , which type of chicken…

A: Deoxyribonucleic acid (DNA) is the genetic material of the most of the organisms that carry coded…

Q: While many commonly used antibiotics interfere with protein synthesis or cell wall formation,…

A: Aminocoumarin is a class of antibiotics that act by an inhibition of DNA gyrase enzyme involved in…

Q: Generally, one single mutation is enough to cause cancer. [Select] Cancer-causing mutations cause…

A: When the genes that control cell division are disrupted, cancer cells are produced. Carcinogenesis…

Q: THE MOLECULAR GENETICS OF CYSTIC FIBROSIS The following is the base sequence of DNA that codes for…

A: According to our guideline we can answer only first 3 subparts of a question. So, upload rest of the…

Q: Like replication and transcription, translation is a process in which the information present within…

A: The process of synthesis of DNA is called replication and the process of synthesis of RNA with the…

Q: Cytosine deaminationoccurs ~100 cytosinesper genome per day in a human genome. Eukaryotic cells…

A: Deamination is the removal of the aminogroup from a base.  For example; the deamination of the…

Q: please help explain Influenza A virus M2 protein triggers mitochondrial DNA-mediated antiviral…

A: This passage delves into a study that reveals captivating bits of knowledge with respect to the…

Q: TRUE FALSE EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle…

A: There are many biomolecules present in an organism and each biomolecule has a specific role.…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: Which statements are true? Explain why or why not.1 The consequences of errors in transcription…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: The binding specificity of σ subunit of RNA polymerase is dependent on DNA sequence.

A: Introduction The RNAP σ(Sigma) Subunit Is Involved In All Steps Of Transcription Initiation, As Well…

Q: Describe how this type of DNA repair works

A: DNA damage is caused due to chemical addition or deletion of a base of DNA which create an abnormal…

Q: Scientists identify a tumor cell in rats that divides more rapidly in the presence of galactose.…

A: Tumor is a kind of lump which is created by the cells dividing uncontrollably. Uncontrolled cell…

Q: UV irradiation often induces DNA damage in the for of pyrimidine dimers. Briefly describe the…

A: UV radiation Natural sunlight stimulates the production of vitamin-D, an important nutrient for the…

Q: The carboxy terminus of the p53 protein acts as an allosteric regulator of sequence-specific DNA…

A: General structure of p53 protein

Q: four friend has just been diagnosed with melanoma and is seeking your help. She has been told that…

A: It has been given that; Friend has been diagnosed with Melanoma. Her gene that coded BR protein has…

Q: Although most cases of cystic fibrosis are inherited in an autosomal recessive manner, it is…

A: Inheritance is the process of transmitting the traits from parent to offspring. Traits of an…

Q: Drug 2-Lumacaftor (VX-809): In people with the most common CF mutation, F508del, a series of…

A: This mutation occurs in the gene cystic fibrosis transmembrane conductance regulator (CFTR).

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.