You are studying a gene that makes a protein product that is important to vision. In which cell types might you expect this gene to be silenced? Choose all correct answers. Only choose "none" if the gene would not be silenced in any of these cell types. ✔none bone marrow cells of an adult cells in the retina of the eye of an adult Opluripotent cells in the developing embryo skin cells of an adult

You are studying a gene that makes a protein product that is important to vision. In which cell types might you expect this gene to be silenced? Choose all correct answers. Only choose "none" if the gene would not be silenced in any of these cell types. ✔none bone marrow cells of an adult cells in the retina of the eye of an adult Opluripotent cells in the developing embryo skin cells of an adult

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Choose the statement that correctly characterizes regulated and/or constitutive gene expression. Regulated expression refers to gene expression that is either on or off, depending on the physiological or metabolic status of the cell. Constitutive expression refers to gene expression that is either on or off, depending on the physiological or metabolic status of the cell. Constitutive expression refers to gene expression that is always repressed in response to the absence of required nutrients or other metabolic molecules. Regulated expression refers to gene expression that is always on, regardless of the metabolic or physiological conditions in the cell. Regulated and constitutive expression are terms used to describe gene expression in prokaryotes only.
Skin cancer is a disease that occurs when skin cells grow in an uncontrolled way it can be caused by UV light, which can cause alter the genetic sequence of skin cells. which choice below is the best describes how uv light might cause skin cancer
Which specialized gene product is responsible for the fusion of mononucleated skin fibroblasts into multinucleated skeletal muscle cells in humans (a type of positive feedback in gene expression)? the glucocorticoid receptor protein the antennapedia protein the PAX-6 protein the MyoD protein the Ey protein
You have developed an activator of a non-receptor tyrosine kinase. In three different cell types that all contain this receptor your drug has different effects. In cell type A you see activation of gene X and gene Y; in cell type B you note activation of Gene X, but no change in the mRNA levels for Gene Y. In cell type C your drug has no effect on either Gene X or Y. Describe how could each choice (A-D) be a possibility to suit the scenario? a. Genes X & Y are controlled by two separate STATs (STAT X & STAT Y). Cell type A contains both STATs; cell type B contains STAT X only; cell type C has neither STAT. b. Genes X & Y are controlled by two separate STATs (STAT X & STAT Y) and two separate JAKs (JAK X & JAK Y). Cell type A contains both STATs and JAKs; cell type B contains both STATs but JAK X only; cell type C has both STATs but neither JAK. c. Genes X & Y are controlled by two separate STATs (STAT X & STAT Y), two separate JAKs (JAK X & JAK Y) and…
All four genes that are used to reprogram differentiated cells to function as pluripotent stem cells are transcription factors that are also known to be protooncogenes. Many of the early adult stem cell transplant experiments showed the development of cancers in the transplanted tissues. Explain.
With respect to the genes that guide development of the embryo (developmental regulatory genes), fill in the missing word(s) in the following statements Hìnt: Knowledge from lecture material will guide your answer Cell signaling molecules operate at the cell surface whereas transcription factors carry out their function within the of the cell • Transcription factors operate by binding to Cell signaling molecules operate by binding to Binding of signaling molecules at the cell surface leads to a series of changes inside responding cells resulting in a change in leading to cellular differentiation.
19: What are 3 phenotypes of GA, or BR, or ABA, or CK over-producing mutants. 20: Think about a hormone receptor, specifically the structure of the receptor. Describe ONE why a mutation would cause insensitivity to the hormone, AND ONE way it could cause hypersensitivity to the hormone. Explain your answer to each. 22: Not all cells in tissues are the same. They differentiate from stem cells. Describe how ONE cell type acquires cell identity. (Pick any cell in the plant)
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGAТАТТАСТGGТААТАТСGGGАTGCAСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCANTATAÇCCCTACGTGATAG promoter RNA polymerase Practice Question 4 A) Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? ribosome ||