You are studying a gene that makes a protein product that is important to vision. In which cell types might you expect this gene to be silenced? Choose all correct answers. Only choose "none" if the gene would not be silenced in any of these cell types. ✔none bone marrow cells of an adult cells in the retina of the eye of an adult Opluripotent cells in the developing embryo skin cells of an adult

You are studying a gene that makes a protein product that is important to vision. In which cell types might you expect this gene to be silenced? Choose all correct answers. Only choose "none" if the gene would not be silenced in any of these cell types. ✔none bone marrow cells of an adult cells in the retina of the eye of an adult Opluripotent cells in the developing embryo skin cells of an adult

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Choose the statement that correctly characterizes regulated and/or constitutive gene expression. Regulated expression refers to gene expression that is either on or off, depending on the physiological or metabolic status of the cell. Constitutive expression refers to gene expression that is either on or off, depending on the physiological or metabolic status of the cell. Constitutive expression refers to gene expression that is always repressed in response to the absence of required nutrients or other metabolic molecules. Regulated expression refers to gene expression that is always on, regardless of the metabolic or physiological conditions in the cell. Regulated and constitutive expression are terms used to describe gene expression in prokaryotes only.
Please asap
List 4 proteins that have different regulatory actions in different cells resulting in cell specialization.
How does gene expression influence the behavior of cells that contain the same genome (genetic information)? In other words, why do cells that belong to the same multicellular organism have a different structure and function?
You have treated undifferentiated embryonic stem cells (ESCs) with sonic hedgehog (Shh)for several days. This should induce a neural fate in your ESCs and you hope that you havebeen successful in differentiating the ESCs into NSCs. What is one assay you could use to testwhether your cells had differentiated into NSC-like cells? Name and shortly describe the assay?
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGAТАТТАСТGGТААТАТСGGGАTGCAСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCANTATAÇCCCTACGTGATAG promoter RNA polymerase Practice Question 4 A) Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? ribosome ||
Which change is most likely to directly interfere with cytokinesis in a dividing animal cell? The loss of a lysine residue in a histone protein A mutation that affects the G2-M cyclin-CDK complex A mutation in the gene that encodes actin A mutation that affects the S cyclin-CDK complex A mutation in the RB gene