**Genetic Code Chart**The image displays a circular genetic code chart, which is used to translate RNA sequences into amino acids, the building blocks of proteins. This chart is also known as a codon chart or codon wheel. It helps in understanding which codons (a sequence of three nucleotides in the messenger RNA) correspond to which amino acids or signaling molecules during the process of protein synthesis.### Structure of the ChartThe chart consists of multiple concentric circles divided into segments, each segment representing the nucleotide sequence:1. **Innermost Circle** - Contains the RNA bases: `G`, `U`, `A`, and `C`, representing guanine, uracil, adenine, and cytosine, respectively.2. **Second Circle** - Lists combinations of two RNA bases that extend from the innermost circle outward.3. **Third Circle** - Continues from the second circle, listing combinations of three RNA bases, which form the codons.4. **Outermost Circle** - Provides the corresponding amino acids or stop signals for each of the codons listed in the third circle. The amino acids are written only on the outer edges of the chart in one-letter or three-letter abbreviations. For instance: - `A` stands for Alanine - `V` stands for Valine - `R` stands for Arginine - `S` stands for Serine - Special signals include: - `START` codon, which initiates translation. - `STOP` codons, which terminate translation.### How to Use the ChartTo determine which amino acid corresponds to a specific codon:1. Start at the center with the first nucleotide of the codon.2. Move to the second circle to match the second nucleotide of the codon.3. Continue to the third circle to find the complete three-nucleotide codon.4. Look outward to the outermost circle to find the corresponding amino acid.#### ExampleFor the codon `AUG`:1. Start with ‘A’ in the innermost circle.2. Move to ‘U’ in the second circle.3. Find ‘G’ in the third circle.4. The outermost circle will show that `AUG` corresponds to Methionine (`M`), which is also the start codon.This chart is crucial for **Using the Codon Table to Decode mRNA**In this exercise, you will learn how to use a codon table to determine the protein sequence that results from a given strand of mRNA.**Problem:**What protein sequence would a cell make from the following mRNA sequence?**mRNA Sequence:** 5’- CCAUGCACCAAUAGAUAACCG-3’**Options:**1. PCTN2. MHQKS3. PCQNRQP4. MHQTo solve this problem, follow these steps:1. **Identify Start Codon**: The process of translation begins at the start codon (AUG) which codes for the amino acid methionine (M).2. **Read the Sequence in Codons**: Divide the mRNA sequence into groups of three nucleotides, termed codons.3. **Translate Each Codon**: Use the codon table to determine the corresponding amino acid for each codon.4. **Stop Codon**: Translation stops at the stop codon (UAA, UAG, UGA), which does not code for an amino acid.**Example:**Let's break down the given mRNA sequence accordingly:1. **AUG** - This is the start codon and codes for Methionine (M).2. **CAC** - This codon codes for Histidine (H).3. **CAA** - This codon codes for Glutamine (Q).4. **UA(G)** - This is a stop codon, signaling the end of translation.Putting it all together:**mRNA Sequence**: 5’- CCAUGCACCAAUAGAUAACCG -3’**Translated Protein Sequence**: M (Methionine) - H (Histidine) - Q (Glutamine)Which equates to option 4: **MHQ****Correct Answer:** 4) MHQ

Name: **Genetic Code Chart**The image displays a circular genetic code char
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: **Genetic Code Chart**The image displays a circular genetic code chart, which is used to translate RNA sequences into amino acids, the building blocks of proteins. This chart is also known as a codon chart or codon wheel. It helps in understanding w