What item/s are true? 1. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND 3'-TAGCCGATG-5' IS PRODUCED. 2. A single change in amino acid can give rise to a multifunctioning protein. 3. A complementary RNA strand is produced during translation.

What item/s are true? 1. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND 3'-TAGCCGATG-5' IS PRODUCED. 2. A single change in amino acid can give rise to a multifunctioning protein. 3. A complementary RNA strand is produced during translation.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 10TYK: A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The...

See similar textbooks

Related questions

Q: Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2.…

A: True or false statement Primase is a kind of RNA polymerase that is involved in the replication of…

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: Answer the following: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine…

A: The central dogma of life is that DNA self replicates to form its own copies. The copied DNA is…

Q: 6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3'…

A: mRNA, or messenger RNA, is a type of RNA molecule that plays a central role in the process of…

Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…

A: We are given a sequence of DNA in 5'-3' direction. We have to generate the mRNA sequence and then a…

Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…

A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: . How many codons are there above in question 8? Label one of them in green.

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: 3. You have assembled a very short contig below, but you don’t know if this is the sense or…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…

A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: 1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U…

A: Only proline amino acid form as second codon is stop codon here

Q: What would the amino acid sequence be for the following DNA Transcript?…

A: DNA is the molecule that stores the information for the coding of the protein sequences in the human…

Q: 20. in differential translation, a different transcript may be recovered depending on which TATA box…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…

Q: 26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C-…

A: Since we only answer one question at a time, we’ll answer question 27 (as you have already solved…

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: It is a large complex ribonucleoprotein particle that chemically modifies the pre mRNA strand by the…

A: A ribonucleoprotein (RNP) is a complex of ribonucleic acid and RNA-binding protein.

Q: Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the…

A: In molecular biology the central dogma states the transcription and translation process in order to…

Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: 6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan…

A: Introduction Gene Regulation: Expression of gene is highly regulated in both prokaryotes as well as…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…

A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…

Q: If this was an eukaryote, what would you find in the leftmost cytosine? 5' Poly A tail 3' Poly A…

A: IntroductionIn eukaryotic mRNA, there are two important structures that are added to the ends of the…

Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…

A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…

Q: 1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA…

A: Since you have asked multiple questions, we will answer first question for you. In order to get…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…

Q: . What is the nucleotide sequence of the complementary strand of the DNA molecule:…

A: DNA or deoxyribose nucleic acid is the genetic material for most organisms. It is a polymer of…

Q: TGTACACATGTCCGAAACAGACTTACCGAA-5

A: For the given DNA Sequence , the translated mRNA is as follows_ 3'TGTACACATGTCCGAAACAGACTTACCGAA5'…

Q: 6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a…

A: Hi! Thank you for the question. since you have not mentioned which part you are looking for, so we…

Q: 1. A DNA base sequence transcribed into messenger RNA in the following sequence:…

A: Introduction :- Transcription is the process through which synthesis of mRNA molecules takes place ,…

Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…

A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…

Q: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA…

A: The central dogma of life involves three processes. They are: Replication: In this process, copies…

Q: 2. A single base addition and a single base deletion approximately 15 bases apart in the MRNA…

A: Introduction :- The hereditary substance in humans and almost all other animals is DNA, or…

Q: (1) Give 3 differences between DNA and RNA (2) Give 2 similarities and 2 differences between…

A: 1) DNA and RNA DNA RNA It is the hereditary and genetic material of cells It is involved in…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical…

A: Codons are made of three nucleotides of DNA or RNA. Each codon codes for an amino acid. The amino…

Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…

Question

What item/s are true?

1. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND 3'-TAGCCGATG-5' IS PRODUCED.

2. A single change in amino acid can give rise to a multifunctioning protein.

3. A complementary RNA strand is produced during translation.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
1). The sequence of mRNA made using the DNA double helix shown below is 2). The sequence of protein made using the mRNA is
1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
What are the correct codons of the MRNA from the given DNA strand that needs to be transcribed? * Sense strand 5' AAT GCC AGT GGT3' Antisense strand MRNA 000 000 TRNA (anticodon) Figure 1. Amino acid (peptide) 3' TTA CGG TCA CCA 5' 5' TTA CGG TCA CCA 3' 3' UUA CGG UCA CCA 5' 3' AAU GCC AGU GGU 5'
1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA product when the DNA is transcribed.c. What is the resulting amino acid sequence which will result from the mRNA?
DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B IC| D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?
Which of the following is/are true? 1. Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty acid chains. 2. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND 3'-TAGCCGATG-5' IS PRODUCED. 3. A single change in amino acid can give rise to a multifunctioning protein. 4. A complementary RNA strand is produced during translation.
1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?
5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5'-GGCAACGGTCCAGTCCAAGTTACG-3' 6. What are the amino acids coded for by this sequence of nucleotides: ATG GGA ACT CCA 7. What is the complementary messenger-RNA sequence for the DNA sequence shown below? ATC GGA CCG ATT GCC
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the mRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' CCGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' mRNA 5' Protein Aline Valine Arginine partic Lysine Asparagine COTOCOAQUC. C FOU U G A Glycine Threonine A GUC A GU G Stop Step Cysteine GTryptophan Phenyl- sarine Lauche C Serie CROUCH UG A C U Hatidine Tyrosine 2060 20/ Leucine Proine