This question refers to the MRNA sequence below: 5'-A ACGAAUAUGUUAAUCGUAGCCACCUGGUUCAGCUAAGGUGA-3' As this mRNA is translated, the sixth codon is Fill in the blank with the correct codon without any spaces, and nothing else so that Moodle can grade this question correctly.

This question refers to the MRNA sequence below: 5'-A ACGAAUAUGUUAAUCGUAGCCACCUGGUUCAGCUAAGGUGA-3' As this mRNA is translated, the sixth codon is Fill in the blank with the correct codon without any spaces, and nothing else so that Moodle can grade this question correctly.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequences
The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the Shine–Dalgarno sequence and the initiator codon.5′¬CUACCAGGAGCAAAGCUAAUGGCUUUA¬3′
During translation, the formation of peptide bonds between adjacent amino acids requires peptidyl transferase enzyme activity, which is carried out by ______________________. Release Factor 23S rRNA of the large ribosomal subunit 16S rRNA of the small ribosomal subunit tRNA A protein enzyme called peptidyl transferase
Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.
Suppose that a protein has the amino acid sequence Met‑Tyr‑Asn‑Val‑Arg‑Val‑Tyr‑Lys‑Ala‑Lys‑Trp‑Leu‑Ile‑His‑Thr‑Pro A researcher plans to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Her probes should be exactly 18 nucleotides in length. Consult the codon table. Select which amino acids in the protein should be used to minimize degeneracy when designing the probes. Val‑Tyr‑Lys‑Ala‑Lys‑Trp Met‑Tyr‑Asn‑Val‑Arg‑Val Arg‑Val‑Tyr‑Lys‑Ala‑Ly Trp‑Leu‑Ile‑His‑Thr‑Pro Calculate the number of different probes that must be synthesized in order to determine the exact cDNA sequence that specifies the region of the protein selected. number of probes:
If a codon GCA codes for the amino acid alanine in a prokaryote, what will it code for in a eukaryote? _____
Please answer all parts of this question
If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA code? Recall that DNA does not use "U" as a base. Enter your answer below using the same format as shown here (three capital letters for each codon, separated by a single dash, no spaces, repeat for each codon). Table 26-1 The Genetic Code First Third Position Position (5'-end) Second Position (3'-end) U C A G Phe UAU UCU UCC Тyr Тyr Stop Stop UGU UGC Cys Cys Stop Trp UUU Ser U UUC Phe Ser UAC C UUA Leu UCA Ser UAA UGA A UUG Leu UCG Ser UAG UGG G Leu Leu Leu Leu CAU САС CAA CAG CUU CCU Pro Pro Pro Pro His His CGU Arg Arg Arg Arg U CỤC CỦA CUG CCC CCA CGC CGA C Gln Gln CCG CGG G Пе Thr ACU АСС ACA ACG AUU AAU Asn AGU Ser U AAC AAA AAG AUC Пе Thr Asn AGC Ser C AUA Ile Thr Lys Lys AGA AGG Arg Arg A A AUG* Met Thr GUU Val Val Val Val GCU GCC GCA GCG Ala GGU GGC GGA Gly Gly Gly Gly U C A GAU GỤC GUA GUG Asp Asp Glu Glu Ala GAC G Ala Ala GAA GAG GGG *AUG also serves as the principal initiation…
Group I and II introns are present in the following classes of RNAS. MRNAS O MIRNAS SİRNAS TRNAS
In the genetic code, both AAU and AAC code for asparagine. For this reason, the code is said to be Degenerate Universal Ambiguous
Biology Question
The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?