This question refers to the MRNA sequence below: 5'-A ACGAAUAUGUUAAUCGUAGCCACCUGGUUCAGCUAAGGUGA-3' As this mRNA is translated, the sixth codon is Fill in the blank with the correct codon without any spaces, and nothing else so that Moodle can grade this question correctly.

This question refers to the MRNA sequence below: 5'-A ACGAAUAUGUUAAUCGUAGCCACCUGGUUCAGCUAAGGUGA-3' As this mRNA is translated, the sixth codon is Fill in the blank with the correct codon without any spaces, and nothing else so that Moodle can grade this question correctly.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: Below is a DNA sequence of the coding strand for a small gene. This gene has no introns.

A: 1. This is a prokaryotic gene because of the absence of introns. In eukarytoes, both introns and…

Q: mRNA sequence of A gene Find 5’ UTR and 3’UTR of mRNA 5’…

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Q: BLOOD DISORDER # 1: mRNA 5' TTAA tRNA nucleus m TT GIA TIT GIA GTGdr TTCCCTTGA ♫ nucleus cytoplasm…

A: Introduction Gene expression is the process through which a gene's information is used to create a…

Q: The central dogma occurs in both prokaryotes and eukaryotes. Transcription and translation occurs in…

A: Central dogma is a process by which instructions present in DNA are converted into the useful…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The 5' cap of TOP mRNAs can be bound by (choose all that apply) i Multiple answers: Multiple answers…

A: Explanation: The 5' cap is important for mRNA stability and translation. It can be bound by…

Q: The set of mRNAs present within a cell changes over time.Explain.

A: The conversion of a liquid into a gas is known as boiling or vaporization. The temperature at which…

Q: RNA sequence of A gene If we have the following mutations, find the type of the mutation…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology DNA --(Transcription)-- RNA --(Translation) -- Protein It says that…

Q: The following RNA polymer is added to an E. coli extract, where it can be translated in all three…

A: A reading frame is the sequence of nucleotides in a nucleic acid (DNA or RNA) molecule read into a…

Q: Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG…

A: In this image the process of transcription is shown where an mRNA is being translated with the help…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: A _____________ is a purine-rich sequence in close proximity to AUG on a prokaryotic mRNA that binds…

A: The answer is Shine- Dalgarno sequence

Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…

A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…

Q: Translation Is Terminated by _______ ________ when a Stop Codon Is Reached.

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: All of the following are needed for capping of eukaryotic mRNA, EXCEPT Question 27 options:…

A: Eukaryotic mRNA is a single-stranded ribonucleic acid. This is associated with the protein…

Q: Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to…

A: Here I will provide you first 10 nucleotides long mRNA sequences according to question.

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: The process of synthesis of proteins from mRNA is called as translation while the process of…

Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…

A: The process of translation in involves three steps - (A) Initiation: it involves binding of a small…

Q: The diagram below depicts an active transcription bubble after a short period of RNA synthesis…

A: Transcription involves the copying of information from a strand of DNA into a new molecule of…

Q: 14.18) Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to…

A: It is important to know how DNA and RNA work together to make proteins. In transcription, DNA helps…

Q: (THIS IS NOT GRADED.) This is NON-MANDATORY homework for a practice assessment. I need some…

A: Translation what is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: Which of the following processing events occur during or after the synthesls of MRNA molecules in…

A: Transcription It is the process of makin copy of RNA from DNA. This RNA is known as messenger RNA

Q: Suppose a mutation occurs in the gene encoding eukaryotic RNA polymerase 1, 2 , or 3 that renders…

A: Abnormalities can vary from a single gene mutation to the addition or deletion of a whole chromosome…

Q: 21. The processing events that must occur on the MRNA after it is transcribed, but before it is…

A: In eukaryotes, transcription and translation take place in different cellular compartments:…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: The queation on my assignment is select the description of an exon? the answers they give are: 1.…

A: An exon is a coding region of the gene that codes for amino acids. In eukaryotes, genes are made up…

Q: Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow…

A: Exons are coding sequences and introns are the non-coding sequences. Splicing is the process of…

Q: The following non-coding sequence (i.e. template strand) is transcribed by the RNA pol II into a…

A: Identify the 5' and 3' ends of the DNA template strand. Write down the complementary bases for each…

Q: Explain what is meant by the concept of "central dogma of molecular biology". Name the main…

A: An explanation of the movement of genetic information within a biological system is the core tenet…

Q: A protein has the following amino acid sequence:…

A: The process of translation requires transfer of genetic information from a polymer of nucleotides to…

Q: The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference…

A: Cells They are the basic, fundamental entity of life.

Q: The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the…

A: Shine-delgrano sequence in mRNA is essential for the binding of prokaryotic ribosomes to carry out…

Q: peptide bonds between adjacent amino acids requires peptidyl transferase enzyme activity, which is…

A: The enzymatic activity of ribosome is called as peptidyl transferase activity. The site of catalysis…

Q: All eukaryotes possess a surveillance pathway referred to asnon-sense-mediated mRNA decay (NMD). Its…

A: There is a great importance of start codon and stop codon in the process of translation. The…

Q: During the transcription elongation step, an internal structure in the RNA Polymerase called…

A: Question - During the transcription elongation step, an internal structure in the RNA Polymerase…

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: The “start” codon is ____ - ____ - ______

Q: This sequence given is of one strand of eukaryotic DNA containing a hypothetical gene. The base that…

A: Answer : DNA---> mRNA ----------> PROTIENS (AMINO ACIDS) A=T, G=C(DNA), A = U(mRNA) From…

Q: Group I and II introns are present in the following classes of RNAS. MRNAS O miRNAS SİRNAS TRNAS

A: Mobile introns are defined as the intervening sequences. These sequences are the ones that are…

Question

Expert Solution

Answer

CGU is the correct answer.

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

The line below represents a mature eukaryotic mRNA. The accompanying list contains many sequences or structures that may or may not be a part of mature eukaryotic mRNA. As accurately as you can, show the location, on the line, of the sequences or structures that belong on the eukaryotic mRNA; then separately list the items that are not part of eukaryotic mature mRNA. 5’____________________________________________________3’ A-stop codon B-poly-A tail C- intron D- 3’UTR E-promoter F- start codon G- AAUAAA H- 5’ UTR I- 5’ cap J- Termination sequence
Q3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the lungs, digestive system and other organs in the body. Cystic fibrosis affects the cells that produce mucus, sweat and digestive juices. The disease occurs when there is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is the gene responsible for the movements of negatively charged particles known as chloride ions into and out of cells. Using the base pairing rules and the codon table, determine the mRNA and protein sequences produced by the CFTR gene's segment (below). Transeription begins at and includes the bold and underlined G nucleotide. CFTR gene's segment. - GCGATGTACAACCGAGGGTAAAAAA - 3' coding sequence a) The DNA template sequence 3'.. ...5' b) Fill in the first 9 nucleotides of the primary/ nascent mRNA transcribed from Gene A. 5'-.... -3' c) Protein N-term... . . C- terminus d) Exposure to cigarette smoke (a known mutagen) deletes base #9…
Please help me complete this solution, i cant figure out what is incoorect about this statement... is the Rrna nee to be repleced with Trna?
In the genetic code, both AAU and AAC code for asparagine. For this reason, the code is said to be Degenerate Universal Ambiguous
Biology Question
Any question please
The eukaryotic mature mRNA sequence will be translated into a polypeptide that is _____ amino acids long (hint remember to "be a ribosome" and scan for the AUG and look out for stop codons!). 5’-CCATTCAUGUUUGGUGGCUAACCA-3’
Do question 28
How Nirenberg and Matthaei determined the first specific codon assignment—UUU codes for phenylalanine.
Define Nonuniversal codons as they apply to the genetic code
A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. Which amino acids in the protein should be used to construct the probes so that the least degeneracy results?
Suppose the codon sequence GUGCAAUUCGAGGCC has a single base pair mutation to GUGCAAUUCAAGGCC. If the old protein sequence was Val-Gln-Phe-Glu-Ala, what will be the new sequence encoded by the mutant gene? ____________________________.