The following double stranded DNA fragment was double digested with BamHI and Kpnl. If you ran the double digest on a gel, how many fragments would you see? Assume complete digestion. BamHI Kpni BamHi Konl 75 + bp 02 3 4 5 6 100 150 150 50

Q: For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show…

A: Polymerase (PCR) chain reaction is a process in which small DNA fragments are amplified into a…

Q: Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?   AccI GT^CGAC…

A: Restriction enzymes are the specific enzymes that recognize and cut at specific sites on nucleotide…

Q: The following DNAs were incubated with E. coli DNA Polymerase I and dNTPs. Write the products…

A: DNA replication is the process by which new DNA is synthesized from the old DNA by semiconservative…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: 1f) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same…

A: Deoxyribonucleic acid  is a particle made out of two polynucleotide chains that loop around one…

Q: A researcher used the Sanger method to sequence the DNA fragment shown. The red asterisk indicates a…

A: Sanger sequencing, also known as the chain termination method, is a technique used to determine the…

Q: functions. The structure that provides high processivity (processivity factor) is represented by the…

A: Letter A denotes core polymerase enzyme B denotes tau protein C denotes gamma clamp loader D denotes…

Q: A DNA fragment with 450 bp will be closer to the top (negative pole) of an electrophoresis gel than…

A: Friedrich Meischer discovered nucleic acids from the nuclei of pus cells and coined the term…

Q: What fraction of the binturong genomic DNA would be considered to be "highly repetitive" DNA, based…

A: DNA is a molecule composed of two polynucleotide chains that coil around each other to form a double…

Q: What allows the peaks to be different colors?

A: DNA sequencing refers to the determination of the nucleotide sequence in the DNA molecule. Automated…

Q: What was the function of each solution or step in the DNA purification protocol? The following…

A: Deoxyribonucleic acid extraction is the isolation and purification of DNA from sample using a…

Q: 1. Epigenetic marks refer to modifications to DNA and proteins that in tum regulate gene expression.…

A: Different macromolecules are present in humans. They include carbohydrates, lipids, proteins, and…

Q: During a typical gel electrophoresis set up (negative pole at the top), which DNA fragment would be…

A: Gel electrophoresis is the technique for the separation of DNA fragments on the basis of size and…

Q: Consider the following image of a stained agarose gel representing the separation of a plece of DNA…

A: Gel electrophoresis is a biochemical technique in which macromolecules such as DNA  can be separated…

Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

A: Plasmids have been used in genetic engineering for cloning and expression. These carry the genes for…

Q: Can you please help with 1d please  picture with 1 graph is for question 1a) picture with 4 graphs…

A: Binturong or the bearcat is found in South and Southeast Asia. It is declared as vulnerable,…

Q: You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10…

A: ANSWER) The amount of DNA digested can be calculated as follows: Total amount of DNA = volume x…

Q: 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: A recombinant protein corresponding to 52 repeats of the peptide sequence YSPTSPS was covalently…

A: The peptide sequence YSPTSPS is a known phosphorylation site that corresponds to the heptad repeat…

Q: 5. The A DNA used for digestion was provided at a concentration of 2ug/ul. How much DNA (in…

A: DNA Should be free of contaminants such as phenol, chloroform, alcohol, EDTA, detergents or…

Q: QUESTION 5 the heteroduplex region is a region that O any DNA that is double stranded O DNA contains…

A: Introduction: Recombination is the process in which there occurs physical exchange of the sequence…

Q: Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA…

A: DNA extraction procedure refers to the methodology that is followed to purify the the DNA (cellular…

Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI BamHI Ncol EcoR1/BamH1 BamHI/Nco1…

A: Plasmids are double-stranded circular DNA molecules. Due to their small size and stability, these…

Q: These are the results after running Agarose Gel Electrophoresis of the cut/uncut pUC19 plasmid and…

A: These are the results after running Agarose Gel Electrophoresis of the cut/uncut pUC19 plasmid and…

Q: Can you please help with 1c please  picture with 1 graph is for question 1a) picture with 4 graphs…

A: We know that E. coli is a prokaryote and Binturong is a eukaryotic animal. On studying the DNA…

Q: The following question is related to Restriction Enzymes and RFLP. Using EcoRl, how many fragments…

A: Restriction enzymes are enzymes that cleave DNA. Each enzyme identifies and chops DNA at or near one…

Q: Procedure Restriction maps for Lambda DNA Lambda DNA may exist as a linear or circular molecule. The…

A: The restriction enzyme is the restriction endonuclease which recognises and cut at the specific…

Q: between the two restriction sites, how would the banding pattern on the gel differ from the one you…

A: Restriction sites are the special palindromic sequences present in DNA. These sites are the location…

Q: Above are the results of gel electrophoresis following digestion with restriction enzymes. What is…

A: Using specialized enzymes known as restriction endonucleases, restriction digestion is a laboratory…

Q: Why was it necessary to mash the strawberries extensively with your hands? (hint: you wouldn’t have…

A: This is the process that is used for the extraction of DNA from the cell. DNA is present in the…

Q: he sequences below indicated the 6bp recognition site for the restriction enzyme EcoRI. The lines…

A: EcoRI is a restriction endonuclease that is isolated from E. coli and is used in the gene cloning…

Q: You have two tubes, each with a pair of DNA fragments inside them. Tube #1 has fragments that are…

A: Electrophoresis  Electrophoresis is used in biological laboratory to separate different size of DNA,…

Q: In the drawing shown below, the top strand (purple) is the template DNA, and the bottom shows the…

A: In the above image, two strands are shown. The top strand being the template DNA and the bottom…

Q: Can you please help with 1c please  picture with 1 graph is for question 1a) picture with 4 graphs…

A: We know that E. coli is a prokaryote and Binturong is a eukaryotic animal. On studying the DNA…

Q: ven though the eukaryotic genome is thousands of times larger than the prokaryotic genome, DNA…

A: Answer: EUKARYOTIC GENOME is more complex and larger than PROKARYOTIC GENOME beacuse prokaryotic…

Q: 1) Prepare the following enzymatic reaction, present it in tabulated form. In a final volume of 30…

A: Enzymatic reactions are essential for all biological processes. They are typically much faster than…

Q: Assume complete digestion of a single linear piece of DNA digested (cut) with EcoRI and Hindill.…

A: A plasmid is a single-stranded, circular DNA molecule that is different from the chromosomal DNA of…

Q: You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10…

A: Plasmid DNA is a small, circular, double-stranded DNA molecule that is commonly found in bacteria…

Q: constructing a map of the plasmid, pDiddy.   What is the smallest fragment size that the…

A: Double digestion Restriction enzymes are eye enzymes that induce cuts(cleavage) at their specific…

Q: Based on the following graph, the number of base pairs of a fragment of DNA that has migrated 39 mm…

A: A separation technique known as electrophoresis relies on the movement of charged species in a…

Q: Why is a DNA double strand break (DSB) a more detrimental lesion than a mismatched nucleotide or a…

A: A cell's genome is continuously harmed, which is unavoidable since DNA damage frequently results…

Q: cule is subjected to complete striction digestion by (1) OKI alone, (2) HindIII alone, and (3) both…

A: Restriction enzymes are a special class of enzyme that cleaves the DNA molecule in particular sites.…

Q: If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample…

A: DNA is composed of two polynucleotide chains that coil around each other to form a double helix. It…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.