The diagram below shows the result of alternative splicing of a given precursor mRNA in two different plant tissues: leaf and seed. Consider a single base pair insertion mutation near the middle of the DNA sequence that gives rise to the RNA region labeled exon 4. GENE VA Genomic DNA exon exon Precursor mRNA exon Transcription Alternative Splicing 5 MG MAXXA exon 5- 5 Leaf Seed Which of the following descriptions of the consequence of this mutation is accurate? OA. The insertion will make the mature mRNA longer in seed. OB. The impact of this insertion depends on which protein this is OC. The insertion will alter the reading frame in leaf but not in seed.

Q: ture MRNA. What are these modifications and what are their significance? Use = following terms to…

A: When introns are eliminated and the mRNA is regarded suitable for translation, eukaryotic pre-mRNA…

Q: ALTE

A: Exon is a genetic code region that contains the information needed to enter a protein code. In…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A:

Q: ng in NOT a function of the CTD of the largest subunit of RNA

A: RNA polymerase II, and specifically the C-terminal domain (CTD) of its largest subunit, has been…

Q: The chromosomal sequences of two mutant alleles of gene A from patients with the zero subtype…

A: DNA is the genetic material. An alteration in the DNA sequence of an organism by the substitution or…

Q: Discuss how the expression of a protein can be regulated post transcription in eukaryotic cells…

A: The eukaryotic cell after transcription called the primary transcript is not considered as messenger…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Suppose that the diagram below represents the genomic organization of an enzyme involved in eye…

A: Transcription is the process by which  RNA transcript is formed from DNA. Various type of RNA are…

Q: Even though the lac Z, Y, and A structural genes are transcribed as a single polycistronic mRNA,…

A: Lac Z, Y, and A are the genes associated with Lac operon that helps bacteria to utilize lactose in…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: What event in eukaryotes serves as the "trigger" for entering the elongation phase of transcription…

A: Transcription occurs in the three steps—initiation, elongation, and termination. The elongation…

Q: ex determination in Drosophila is controlled by a cascade of alternative splicing events.…

A: Sxl is an RNA binding protein that participates in alternative splicing and translation.

Q: Concentration (%) A researcher is studying environmental conditions that cause the expression of…

A: We analyze the correlation between pH values and active repressor concentration to identify the…

Q: What region would provide cell type-specific expression of genes? region  What site would…

A: The mRNA is given in the figure. The mRNA undergoes the process of translation to produce protein.

Q: As shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and…

A: The pre-mRNA is formed from the DNA, which is further spliced to form mature mRNA. Splicing refers…

Q: None

A: Here is the matching of each aspect of transcription or translation with the appropriate motif,…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…

Q: Which of the following is true for gene regulation in both bacteria and eukaryotes? Selected answer…

A: Gene regulation refers to the act of activating and deactivating genes. Cells start to perform…

Q: Which of the following processing events occur during or after the synthesls of MRNA molecules in…

A: Transcription  It is the process of makin copy of RNA from DNA. This RNA is known as messenger RNA

Q: start with four exons and show mutually exclusive splicing producing 1-2-4 and 1-3-4 spliced exons.…

A: Mutually exclusive splicing is a phenomenon in which different exons are alternatively spliced,…

Q: What conditions would we find on the gene of a prokaryote if there is low amounts of tryptophan…

A: Tryptophan is less common amino acid found in protein. They plays an important role in structural…

Q: In humans, the average length of a gene on chromosome 7 is 69,000 base pairs, but the average mRNA…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Choose any/all that apply to mRNA processing in eukaryotes. The "starter/initiator" methionine codon…

A: The transcript that is produced as a result of transcription of an eukaryotic DNA sequence is called…

Q: From the list given - choose all the regulatory sequences that you think would control the…

A: A regulatory sequence is a nucleic acid molecule segment that has the ability to increase or…

Q: Select all the possible mutation types for the following observed phenotype resulting from a…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’   An…

A:

Q: Choose all that apply regarding gene transcription in eukaryotes: Multiple transcription factors are…

A: Transcription in eukaryotes.

Q: What is the mechanism for addition of a guanosine to create the 5' methyl cap of a MRNA? O The 5'-OH…

A: Mature mRNA is an mRNA that is modified post-transcriptionally. Mature mRNA carries information from…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.