ex determination in Drosophila is controlled by a cascade of alternative splicing events.  Sex-lethal (Sxl) is involved in regulating splicing of the transformer gene, as outlined below (picture attached). According to this schematic, Sxl functions as a: Splicing enhancer   Splicing repressor   Splicing activator   Splicing silencer

Q: he Drosophila oocyte/embryos A-F show the expression patterns of various mRNAs.  Which is the…

A: Fruit flies, or Drosophila melanogaster, have led to significant research as model organisms in…

Q: What would be the most likely effect of inhibiting the translation of hunchback mRNA throughout a…

A: A gene is the basic functional, and physical unit of heredity and it is small sections of DNA that…

Q: Describe the cis-acting elements that control tissuespecific transcription of eukaryotic…

A: The transcriptional machinery of eukaryotes consists of two regulatory components, namely the…

Q: How regulatory protein can regulate/inhibit the gene expression?  Please explain at your own words.

A: The gene expression is the production of RNA from DNA or gene by the process called transcription.…

Q: Debes et al recently described how aging in humans, mice, nematodes, and other eukaryotes is…

A: Mediator Proteins:Prediction: Overexpression of Mediator proteins would likely reduce…

Q: Describe how P elements are used to producetransgenic Drosophila.

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: Discuss all the different ways and mechanisms that eukaryotes use to regulate gene expression.

A: Given:  The different ways and mechanisms that eukaryotes use to regulate gene expression.

Q: Alternative splicing takes place in more than 95% of the human protein-encoding genes with multiple…

A: In alternative splicing, a single pre-mRNA may be spliced in two or even more ways depending upon…

Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…

A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…

Q: Typically, increased acetylation and decreased methylation of histone N-terminal tails in…

A: Histone acetylation and deacetylation are the processes by which the lysine deposits inside the…

Q: Regulation of transcription is mediated by proteins that first must bind to specific…

A: Hi dear,here is your answer. Gene expression is defined as the process by which the information that…

Q: Name the lambda promoters whose expression is regulated by the cro protein. For each promoter you…

A: CI represses cro and Cro represses cI. This is referred to as the double-negative feedback loop and…

Q: Which of the following is NOT a property of general tra ripion O Each eukaryotic gene utilizes a…

A: Transcription factors are proteins that play a crucial role in regulating gene expression. They bind…

Q: You have been analyzing wing development mutants in Drosophila and have collected the…

A: Gene masking is simply a genetic algorithm that builds a template for a chromosome, called a mask,…

Q: Discuss histone remodeling and its effect on transcription.

A: Histone-modifying complexes are protein complexes that catalyse the addition or removal of different…

Q: Which of the following applies to the female sex determination in Drosophila melanogaster fruit…

A: Sex-lethal (Sxl) is the master switch gene for somatic sex determination in Drosophila melanogaster.…

Q: Explain how splicing happens in 4-5 sentences. No more than 5 sentences please

A: Splicing occurs in the nucleus of the cell. It is the process of transformation of pre-mRNA to mRNA…

Q: Describe the cis-acting elements that control tissue-specific transcription of eukaryotic…

A: Step 1 Transcription is the formation of RNA (ribonucleic acid) over the template of DNA…

Q: Most eukaryotic promoters have binding sites for several different transcription factors, and the…

A: In bioinformatics, incorporating preexisting route information into microarray data has become a…

Q: Briefly explain how different modifications of histone protein affects the epigenetics of a gene

A: Epigenetics is the study of the gene in which DNA sequence does not change. The epigenetic change…

Q: Consider the CT/CGRP example of alternative splicing. Which different types of alternative splicing…

A: Alternative splicing is a technique that allows messenger RNA (mRNA) to control the production of…

Q: Which of the following are ways in which transcriptional repressors can function in eukaryotes?…

A: Enhancers are DNA regulatory elements that can enhance or increase the transcription of genes.…

Q: Which of the following mode of gene regulation CANNOT be regarded as "transcriptional regulation"…

A:

Q: Formation of a GC-rich stem-loop in the mRNA is required for function of an intrinsic transcription…

A: Transcription is the process in which mRNA corresponding to a gene is synthesized by RNA Polymerase.…

Q: Name four control points of regulation of eukaryotic gene expression, and where they occur in the…

A: The four control points of regulation of eukaryotic gene expression are – Epigenetics Transcription…

Q: Describe two different ways that histone modifications may alter chromatin structure.

A: Chromosomes appear at the time of cell division in the form of thread like structures inside the…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other…

A: Hi! As you have posted multiple questions, I will be answering the first question for you. If you…

Q: There is a situation in which a gene has five exons. Please draw four possible mature products of…

A: Alternative splicing is a biological process that involves the joining of exons from the same gene…

Q: List two different ways in which trans-acting small RNAs(sRNAs) regulate the expression of target…

A: Trans-acting small RNAs or ta-siRNA are a class of siRNA that is responsible for repressing gene…

Q: Three similar proteins are expressed in human tissues: HHT1 is expressed in the liver,  HHT2 is…

A: Introduction Proteins are huge biomolecules and macromolecules that are made up of one or more long…