The answer is option A In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the complementary strand. Step 2 In the above question, the two sequences of 21bp primers in the 5' to 3' Orientation that allows amplifying the given gene sequence are : ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA CAN YOU FURTHER EXPLAIN WHY IT IS "GTCAAATTACATTACACATAA," I don't understand why it's called reverse primer? and where exactly it is binding to on the strand? (A picture would really help)
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
The answer is option A
In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the complementary strand.
Step 2
In the above question, the two sequences of 21bp primers in the 5' to 3' Orientation that allows amplifying the given gene sequence are :
ATGTTTGTTTTTCTTGTTTTA and
GTCAAATTACATTACACATAA
CAN YOU FURTHER EXPLAIN WHY IT IS "GTCAAATTACATTACACATAA," I don't understand why it's called reverse primer? and where exactly it is binding to on the strand? (A picture would really help)


Step by step
Solved in 3 steps with 1 images









