Table 5: Effect of Dietary Fiber on Bile Acid AdsorptionOptical Density (OD) of Colored Filtrate (Reflects Amountof Bile Acid in Filtrate)1- OD (Reflects Amount of Bile Acid Adsorbed by FoodParticles)Fiber-Fiber-Fiber-Fiber-Bile AcidWith BufferSolution (NoFibers)Bile AcidWith BufferStandard StandardRichRichStandard StandardRichRichMealMealMealMealМealMealМealMealWith BileExperimental Solution (NoTrialsWithout With BileWithoutWithout With Bile Without With BileFibers)BileAcidBileAcidBileAcidBileAcid110.550.40.0020.610.4310.520.32AverageEquations (f,)Use these formulas for making your calculations. Round your answer to the nearest tenth.AveragesAdd the values from the three trials (or subjects); divide by three.Index reflecting the level of bile acid adsorptionThis index is equal to 1- OD, where OD is optical density of the colorized supernatant of mixtures of the studied food. This indexreflects the amount of bile acid adsorbed by food particles.

A "well-balanced diet" helps to keep illnesses and infections at bay. The body systems improve when…

Table 5: Effect of Dietary Fiber on Bile Acid Adsorption Optical Density (OD) of Colored Filtrate (Reflects Amount of Bile Acid in Filtrate) 1- OD (Reflects Amount of Bile Acid Adsorbed by Food Particles) Fiber- Rich Fiber- Rich Meal Fiber- Fiber- Standard Standard Meal Bile Acid Rich Rich Bile Acid Standard Standard With Buffer Meal Meal Meal With Buffer Meal Meal Meal Experimental Solution (No Without With Bile Without With Bile Solution (No Without With Bile Without With Bile Acid Trials Fibers) Bile Acid Bile Fibers) Bile Acid Bile Acid 0.55 0.4 0.00 0.61 0.4 0.52 0.32 Average Equations (fx) Use these formulas for making your calculations. Round your answer to the nearest tenth. Averages Add the values from the three trials (or subjects); divide by three. Index reflecting the level of bile acid adsorption This index is equal to 1- OD, where OD is optical density of the colorized supernatant of mixtures of the studied food. This index reflects the amount of bile acid adsorbed by food particles. O O

Table 5: Effect of Dietary Fiber on Bile Acid Adsorption Optical Density (OD) of Colored Filtrate (Reflects Amount of Bile Acid in Filtrate) 1- OD (Reflects Amount of Bile Acid Adsorbed by Food Particles) Fiber- Rich Fiber- Rich Meal Fiber- Fiber- Standard Standard Meal Bile Acid Rich Rich Bile Acid Standard Standard With Buffer Meal Meal Meal With Buffer Meal Meal Meal Experimental Solution (No Without With Bile Without With Bile Solution (No Without With Bile Without With Bile Acid Trials Fibers) Bile Acid Bile Fibers) Bile Acid Bile Acid 0.55 0.4 0.00 0.61 0.4 0.52 0.32 Average Equations (fx) Use these formulas for making your calculations. Round your answer to the nearest tenth. Averages Add the values from the three trials (or subjects); divide by three. Index reflecting the level of bile acid adsorption This index is equal to 1- OD, where OD is optical density of the colorized supernatant of mixtures of the studied food. This index reflects the amount of bile acid adsorbed by food particles. O O

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Vasopressin: CYFQNCPRG Oxytocin: CYIQNCPLG Calculate the pI of each peptide. How could the differences affect their function.
Based on the 2020-25 Dietary Guidelines, what is the % Daily Value for fiber for a strawberry-banana smoothie with 7 grams of fiber? The first step is to identify the Daily Value for fiber, which is grams. The next step is to divide the amount of fiber in the smoothie grams by the Daily Value for fiber. Then, multiply by 100 to get the % Daily Value of % (type in the numbers only, no units, and round to the nearest whole number).
Please don't provide handwriting solution
Provide background about the coagulation of protein in dairy foods. In particular, explain how different milks (full cream, skim, soy) and coagulents (rennet tablet, lemon juice, vinegar & calcium sulphate) change the consistency of cheese. Provide rationale for why different coagulants should be investigated.
i. What are the advantages of biological value of protein method compared to N-balance and chemical score? ii. A bull consumes 7 kg DM of feed containing 60 g N/kg. The bull excretes 120 g N in the faeces and 50 g N in the urine. The feacal and urinary N had 20 g metabolic feacal nitrogen (MFN) and 6 g endogenous urinary nitrogen (EUN) respectively. Calculate the BV of the protein in the diet.
9. During replication, what protein is responsible for the synthesis of a short ribonucleotide sequence? A. A helicase B. A DNA polymerase C. A primase D. A topoisomerase E. A ribosome
14
stock aliquot - 1mg/ml use the sequence below to determine the molarity using ExPASy Translate and protProt Program atgggcgaggagtataaagttgtcctcacatttggatccccaatgagccctaatgcaaataacaaacagacttgggttaataaacctcttgatgcgccttcgggccattacaatgtgaaaattgcaaaggatgttgaccactatctaaccatgcagggtttcacttctatagcatctgttgactggtacactatagattttcaaccatctgaggcgcctgccccgataaaaggcttgcaggtacttgtgaacatctcgaaaaaagctgatgtgtatgccgtcaaacaatttgtcacagcgcagaccaacaacaagcaccaggttacaagcctgttcctagtaaaagtaacaactggttttcaggtgaacaactacctgagttacttttacagggcgtctgctactggggatgccacaactaacctgttggttagaggagacacatacacagcagggataagttttacccagggtggatggtatttgttgacaaatacatctattgttgatggggctatgccacctggctgggtctggaataacgtggaacttaaaactaacacagcgtatcacatggacaaaggcttggtccatctaataatgcctttgcctgagtccacgcaaatgtgttatgagatgctgacatctattccagcggccgcagagctcgctctggtgccacgcggtagttccgctcatcaccaccatcatcaccatcaccaccact
explain why these 3 do not contain any fiber -1 cup vanilla yogurt ( low fat ) -1 cup of non-fat milk -3oz lean roast beef, bottom round