RNA 5 UA ACACAUGAUUUUCGUAAAAUGUCUGACUUCCAAC UAA protein ILE PHE VAL LYS CYS LEU THR SER ASN MET Table 2. deletion at position #2 No Start cadon 3 5 RNA 5 AAACAUGANYUUCGUAAAAUGUCUGACVUCCAAG protein PWES SER Table 3. addition at position #5 ASUVAL LEURRO
Q: Hello, Can you help me to describe the characteristics of Antimicrobial Agents? Characteristics of…
A: Let's break down each of the characteristics of an ideal antimicrobial agent, with a detailed…
Q: how toxicology contributes to understanding the potential risks from toxic substances and aids in…
A: Toxicology is the scientific study of adverse effects that occur in living organisms due to…
Q: In paragraph form, you should describe what you found. This is not the place to interpret results,…
A: In figure 1 the isopod survivors against the victims are displayed, as well as the average time it…
Q: Resting membrane potential (assume the following initial conditions; EK = -81 mV, ENa = 58 mV, b =…
A: a) is correct: In order to preserve the resting membrane potential, the Na+/K+ ATPase pump actively…
Q: What is the actual length of the pollen grain in micrometres (um)? The magnification is X1200. The…
A: IntroductionThe measurement of microscopic objects, such as pollen grains, is crucial in various…
Q: Which order doesn't belong to mammalian: monotremata, lagomata, Insectivora, sohenondon or edentata
A: The question is asking us to identify which of the given orders does not belong to the class…
Q: What is a synchondroses joint? what kind of connective tissue it contains and what functional…
A: Synchondroses Joint (Cartilaginous Joint Type)- **Structure**: A synchondroses joint is formed where…
Q: Hello, We are doing a discusion in Biology class about bacterium. I am stuck In this…
A: Here's the updated description with the addition:Clostridium botulinum is a gram-positive,…
Q: What is Zomedica's TRUFORMA Inspiration and early invention, creators, developers What are Major…
A: Zomedica's TRUFORMA is an innovative diagnostic platform designed for the detection of thyroid and…
Q: • Is this anabolism or catabolism? • Can you describe the movement of electrons? plasma membrane…
A: A comprehensive response, complete with appropriate explanations and reasoning has been provided in…
Q: The mucosal immune system overall is characterized by a state of non-activity, short reactions of…
A: True. Reason:The mucosal immune system, such as in the gut, respiratory tract, and urogenital…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt. Answer in all options.
A: A Punnett square is a tool used in genetics to predict the potential outcomes of a genetic cross by…
Q: 3. A population has a nucleotide diversity (p) of 0.08 and a neutral mutation rate of 5' 10" per…
A: Part a: Effective Population Size Calculation and InterpretationThe effective population size (Ne)…
Q: #25
A: Analyzing Comb Shape in ChickensUnderstanding the Genetic Basis:Walnut Comb: R_P_ (at least one…
Q: 2). What is the maximum frequency of recombinant gametes? Illustrate this in an F1 individual with 2…
A: The maximum frequency of recombinant gametes is 50%. This occurs when two genes are far enough apart…
Q: Don't use Ai and chatgpt. Answer in step by step with explanation.
A: A. Epithelial cells form continuous layers of tightly packed cells.Explanation: Epithelial cells are…
Q: Consider a diploid cell that contains three pairs of chromosomes designated AA, BB, CC. each pair…
A: In mitosis, a cell divides to produce two genetically identical daughter cells. This process…
Q: Holstein (Bos taurus) produces a high milk yield with good butterfat and protein content, making it…
A: Holstein (Bos taurus): Known for high milk yield with moderate butterfat content (3.5%), making it…
Q: Hello, What else would you add to this explanation about "Ascaris lumbricoides", can be any cusious…
A: Your explanation of Ascaris lumbricoides is informative and covers a wide range of key points. Here…
Q: Just wondering if I'm doing these correctly
A: Dear student, please mark the answer helpful if it helped you understand this question. A…
Q: please help im confused thank you a lot
A: Differences Between the Tetrapod Lineage Based on Morphology and Mitochondrial DNAThe Tetrapod…
Q: Cell 20% salt 80% water
A: The question states that a cell contains 20% salt and 80% water. This means that if we were to take…
Q: (a) what is happening in METAPHASE II? Include Crossing Over and Independent Assortment when they…
A: Metaphase IIIn Metaphase II, the chromosomes line up along the cell's equatorial plane, known as the…
Q: In what procedure(s) might the degenerate base code be important?
A: Approach to solving the question: Detailed explanation: 1. PCR or Polymerase Chain…
Q: year. arses/38105/quizzes/220159/take Explain why there is such a difference in the amount of CO2…
A: Mauna Loa is actually located in the Northern Hemisphere, but the options provided seem to reference…
Q: How may the abuse of drugs relate to the plasticity of the brain?
A: Brain plasticity, also known as neuroplasticity, refers to the brain's ability to change and adapt…
Q: Barrier islands have been hard to protect because links between them and inshore ecosystems are…
A: Barrier islands are crucial for a variety of reasons. They serve as a buffer zone, absorbing the…
Q: 5). Draw a diagram of a bivalent and label the following parts: centromere, sister chromatids,…
A: The diagram is given below: Key components:Homologous chromosomes: A pair of chromosomes, one…
Q: an example of a chemical carcinogen in pesticides
A: A carcinogen is any substance, radionuclide, or radiation that promotes carcinogenesis, the…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt. Answer in all options.
A: The answer is B. Inhibition of CDK2.Myc is a proto-oncogene that plays a central role in regulating…
Q: In a certain reptile, eyes can be either black or yellow. Two black eyed lizards are crossed, and…
A: First, we need to identify the observed and expected frequencies. The observed frequencies are the…
Q: Compare and contrast between ex-situ and in-situ conservation
A: Ex-situ conservation is the process of protecting an endangered species of plant or animal by…
Q: A reaction like cellular respiration that breaks down organic molecules is called a reaction.
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: From this cross where RRYY is round yellow and rryy is wrinkled green, how do I calculate the number…
A: Explanation:This Punnett square represents a dihybrid cross involving two genes, each with two…
Q: Is there a relationship between growth rates and carrying capacity? Explain. Answer This Question…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: You buy a new PCR kit. The starting concentration for each reagent is as follows: the primers are…
A: To prepare your PCR reaction with the desired final concentrations, you need to calculate the…
Q: How do I draw a diagram for Phosphoenolpyruvate (PEP) + ADP → Pyruvate + ATP to show the effect of…
A: The reaction you're referring to is a key step in the process of glycolysis, where…
Q: Hello, Can you please help me with the next question? (I would apreciate a short answer). Based on…
A:
Q: A pollen grain of corn with nuclei labeled M, N, O fertilized an embryo sac with nuclei labeledR, S,…
A: In corn, fertilization involves the fusion of the male gamete (pollen grain) with the female gamete…
Q: What are keratinocytes and what do they do? 2. Which layer(s) of epidermis do I find melanocytes…
A: 1. What are Keratinocytes and What Do They Do? Keratinocytes are the predominant cell type found in…
Q: Hello, Beside this, what else do you think I can say about "Staphylococcus aureus"? "is a common…
A: To add more detail about Staphylococcus aureus, you could expand on its characteristics, modes of…
Q: A pollen grain of corn with nuclei labeled M, N, O fertilized an embryo sac with nuclei labeled R,…
A: In the process of fertilization in plants, the pollen grain (male gametophyte) lands on the stigma…
Q: #19
A: Approach to solving the question: Detailed explanation: To solve the problem, we will analyze each…
Q: A patient develops sudden breathing problems after recently increasing his workouts. He presents…
A: To evaluate the scenario and the spirometry readings provided, let's first understand the basics of…
Q: Why is X-inactivation necessary in individuals with two X chromosomes?
A: X-inactivation, also known as lyonization, is a process that occurs in female mammals (who have two…
Q: What tissue membrane is responsible for getting big, snotty, runny noses when you are sick?2. What…
A: The tissue membrane responsible for getting big, snotty, and runny noses when you are sick is the…
Q: Whats the concentration of the “unknown protein?” It has an absorbance of 0.35
A: Solution:From the equation obtained from the standard calibration curve, the unknown-protein could…
Q: Imagine that you are part of a research team that specializes in diagnosing disorders associated…
A: The diagnostic analysis of a two-day-old newborn male patient with systemic symptoms highlights the…
Q: None
A: Osmosis:Osmosis is the movement of water molecules through a selectively permeable membrane from an…
Q: Describe three mechanisms of how adrenergic stimulation of nodal cells and/or cardiocytes increases…
A: Adrenergic stimulation plays a crucial role in regulating heart rate (chronotropy) and contraction…
Can you translate table 2 protein
Step by step
Solved in 2 steps
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleACG< QNA RNA type f base Tyre of Engan desry- bJA Seatwork: DNA or RNA strand ONA NH2 hnu - RU4 NH 4. N- 2 - NH2 но -р-о но- OH онон NH2 H2N 1. NH N: но но 0-P-0-P- OH OH ононEcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
- Normal dna sequence: TAC ACC TTG GCG ACG ACT. Note: this is not for a grade.UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter
- 2. Here is the detailed view of the MCS of the PUC19 plasmid: Sma I KpnI SbfI PstI SacI XbaI ECORI BamHI Sall SphI HindIII agt GAATTCGAGCTCGGTACCCGGGGA TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGcgtaatcatggtcat 400 410 420 430 440 450 460 ...S N S SP VR PDEL TS R CAH LS P T IM T M lacZa translational start Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA that would be cut out. Show both strands. For reference, here are the recognition sequences: 5' G|GAT СС 3' 3' С СТАG|G 5' recognition sequence for BamH I 5' G GTAC|C 3' 3' cl CATG G 5' recognition sequence for Kpn I Figure 26: recognition sequences for BamH I and Kpn IRNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
- me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…A8Please answer the following question, thank you!