Question 2 Which of the following is not a key step in the activation of MRNA synthesis in eukaryotes? A Binding of RNA Pol I. B) Binding of TBP to the DNA. Phosphorylation of the RNA Pol. D Binding of other transcription factors.

Q: Under which conditions does the trp repressor block transcription of the trp operon? when the…

A: The trp operon responds to a repressor protein that binds to two molecules of tryptophan. When the…

Q: Question:- Which statement below about gene expression is TRUE? A. Transcription initiation begins…

A: A gene is a part of DNA that codes for a particular protein. Each Jean carries a particular set of…

Q: Which of the following traces the path of a protein from transcription to localization in the…

A: Protein synthesis is an unique process during which cells make their own proteins, in a two step…

Q: Examine the following theoretical operon (gen) in E. coli which contains structural genes (genC,…

A: Question 4: No, a null mutation in the regulator gene would not be considered a gain-of-function…

Q: Which of the following aspects of transcription is true for bacteria but not Eukaryotes? O…

A: A cell is the basic fundamental unit of a living organism. Living organisms are divided on the basis…

Q: The following image represents a gene model. Which part is (are) exon(s)? type your answer... Which…

A: Eukaryotic protein-coding genes are segments of DNA in eukaryotic organisms that contain…

Q: Question 1: While examining a gene related to calcium ion channels in humans (CACNA1S) you discover…

A: D IS THE CORRECT ANSWER. AND EXPLANATION IS GIVEN BELOW .Explanation:

Q: Question 11 What is this a diagram of? -35 L (6 bp) (17-19 bp) O Promoter region recognized by…

A: Genes are hereditary units exhibited on the chromosome. They stores genetic information. Genetic…

Q: The lac repressor in bacteria and when lactose is present, the lac genes O Inhibits transcription of…

A: The lac repressor inhibits the transcription. In lactose metabolism, the lac operon is very much…

Q: What will be the anticodons that will arrive in the translation of MRNA below? MRNA 5 -…

A: The translation is a process of conversion of RNA codon sequences into their respective amino acid…

Q: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the…

A: Introduction Gene expression is the process through which a gene's information is used to create a…

Q: What is the name of the site where RNA polymerase binds to the DNA prior to the beginning of…

A:

Q: Which best describes the fate of this protein?

A: The correct answer to this question is: The protein remains in the cytosol

Q: Why is it reasonable that eukaryotes have aDNA polymerase (Pol ) that operates only in…

A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…

Q: Spliceosome   Question 24 options:   consists of small nuclear ribonucleoproteins (snRNPs).   is…

A: Scientists are being inspired by RNA sequencing to push the boundaries of current research…

Q: Which of the following statements is/are TRUE about the difference between prokaryotic and…

A: Introduction Translation is the process by which protein is synthesized with the help of…

Q: Review Concept 17.1 Match the term and its description. Each term can only be used once. In this two…

A: Within each cell, the process of turning a gene into a protein is complicated and closely regulated.…

Q: Let's assume there is an inhibitor that binds to all signal recognition particles (SRPS) covalently,…

A: Signal recognition particle (SRP) is very important protein that binds with the signal sequence (SS)…

Q: QUESTION 10 Of the proteins listed below, choose all of those that are part of the basal…

A: As per the central dogma of molecular biology, direction of flow of information is DNA RNA Protein.…

Q: GQ15

A: The image you sent is related to alternative splicing, which is a process that removes certain parts…

Q: Question 3. Why must RNA splicing be absolutely precise?

A: RNA Splicing refers to the removal or cutting of non-coding regions of RNA (introns) from mRNA and…

Q: Suppose the DNA sequence of a gene with 5 exons contains a mutation at the 5’ end of intron 2.…

A: The protein translation is the process of the formation of proteins from the mRNA formed from the…

Q: There is a specific enzyme that adds the 5' Cap to mRNA. If an inhibitor of this enzyme were added…

A: Cap in RNA is a molecule of 7 methyl guanosine at 5' end.

Q: Briefly describe an experiment you could perform to isolate ER-associated ribosomes and test if…

A: Ribosomes are cell organelles that are the site of important cellular processes such as translation…

Q: Assume a bacterial cell has a mutation in the gene that codes for CRP, such that the mutant CRP-CAMP…

A: An operon is a set of structural genes regulated by a common promoter in bacteria.

Q: Question 3 Choose the false statement below. O CRISPR is a protein complex which causes the…

A: "Biotechnology" is the use of our knowledge of biological processes to the development of beneficial…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: In the case of the insulin receptor (IR), the RNA-binding protein RBP described in lecture in muscle…

A: RNA binding proteins bids to mRNA based on structure or sequence and form ribonucleoprotein…

Q: In humans, miRNAs are thought to regulate the expression of at least one-third of all protein-…

A: RNA (Ribonucleic acid) is a single-stranded nucleic acid that is present in all living cells. It is…

Q: Cigarette smoke contains at least fifty-five different chemicals identified as carcinogenic (cancer…

A: Carcinogens are agents that may be chemicals, radiations or pathogens that May directly alter the…

Q: Match the items listed below with "eukaryotic" if they can be found in eukaryotic cells only,…

A: Polyadenylation signal sequence - Eukaryotic Shine Dalgarno sequence - Prokaryotic mRNA - Both tRNA…

Q: What is the Shine-Dalgarno sequence?   Question 15 options:   A consensus sequence in prokaryotic…

A: The process by which mRNA is produced from DNA is called transcription and the process by which…

Q: 1)HSP 70 is a chaperone protein that aids the folding of newly formed polypeptides during…

A: Introduction  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: Retroviruses are used in gene therapy. The goal of gene therapy is to insert in the patient genome a…

A: Introduction :- Gene therapy is the process of changing the genes in your body's cells in order to…

Q: You are a scientist studying drug resistance in cancer. You are particularly interested in ABCB1, a…

A: Cancer causes the uncontrolled growth of abnormal cells and dynamic altering in the genome. Common…

Q: Identify the eukaryotic level of gene regulation. Choose the correct answer below. a. Pre-…

A: INTRODUCTION Eukaryotic level of gene regulation include epigenetic, transcriptional, post…

Q: Which of the following are the enzymes involved in post-transcriptional modification?   Question…

A: The objective of the question is to identify the enzymes involved in post-transcriptional…

Q: Which of the following is REQUIRED FOR co-translational import into the rough ER? O A signal peptide…

A: Endoplasmic reticulum is the cell organelle which play the important role in the regulation of…

Q: 1. Below is a gene on DNA in a prokaryotic cell. Draw the mRNA molecule that would be made from this…

A: It can exist in various forms like primary, secondary and tertiary based on its level of…

Q: Question 1: The c-myc gene has several exons. What are the stages of the maturation process that its…

A: Introduction - The cellular equivalent of the retroviral v-myc oncogene, the c-myc gene, was found…

Q: Transcription factors are a specific type of nuclear proteins. How do transcription factors get…

A: Transcription factors are proteins that bind to the specific DNA sequences in or around the…

Q: A wild-type E.coli cell is growing in media with high glucose and high lactose. Which of the…

A: Lac operon- The lac operon is negatively inducible.  It contains gene for lactose metabolism. It is…

Q: The following prokaryotic DNA is transcribed into RNA and the mRNA transcript is translated into…

A: The central dogma of molecular biology tells us how the genetic information is stored within a cell,…

Q: QUESTION 8 What is the function of the amp' gene in a vector? OA It is a restriction enzyme…

A: A cloning vector is a small piece of DNA that can be stably maintained in an organism, and into…

Q: An R loop experiment was performed on two different mRNA's. The first showed one R loop, while the…

A: Eukaryotic mRNA is transcribed post-transcriptionally to form mature mRNA. The post-transcriptional…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.