Here is the sequence of an mRNA molecule: GUC/GGG/CUC/AGA/GAA What is the protein sequence that would be made from this mRNA sequence? The slash marks ("/") shown in the above sequence are so that you can read the sequence easier. The slash marks that are shown between the blanks below are to help you keep your place in the protein sequence. Use the genetic code below to help answer this question. ***Only use the 3-letter code for each amino acid (for example, Phe or Leu) for your answers, or else they will be marked wrong!***

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: For each of the following mRNA sequences predict the appropriate protein sequence: a.…

A: Genetic code refers to the instructions contained in a gene that instructs a cell how to make a…

Q: A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes…

A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…

Q: BLOOD DISORDER # 1: mRNA 5' TTAA tRNA nucleus m TT GIA TIT GIA GTGdr TTCCCTTGA ♫ nucleus cytoplasm…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Select an answer and…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: Bacteria Eukaryotes First amino acid 5' end 3' end Cistron Introns/exons

A: Bacterial and eukaryotic m-RNA is different from each other in bacterial translation first amino…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…

A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…

Q: Draw a line representing mRNA that has already been processes (introns removed, cap and tail added).…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Decode the unknown word using the genetic code and fill out the missing nucleotides. Translate the…

A: The disorders of the blood influence or alter the functioning of the red blood cells, white blood…

Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…

A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The sequence: ATTGCCGACGACTTG is complementary to a sequence that is used as a template in…

A: (-) Sense

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Describe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: A small section of mRNA codons has the following sequence: CCU GUA CAC GUC Some Amino Acids Stop…

A: mRNA is the messenger RNA which is used as a template strand for the protein synthesis.

Q: Sequence A: 37 TCT/TCC/CTC/CTA/AAC/GTT/CAA/CCG/GTT/CTT/AAT/…

A: To identify the middle, end, and beginning sequences, we need to analyze the mRNA sequences and look…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: The cell is the basic structural and functional unit of the body. The nucleus is called the brain of…

Q: and each codon is made up of three nucleotide bases. How might an extra single base INSERTION into…

A: Any abrupt changes in DNA nucleotide is called muttaion.Depending on where the changes occurred…

Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…

A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: Mutations are the changes in the genome resulting in synthesis of different products. These changes…

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids…

A: The process of synthesis of messenger RNA with the help of template DNA strand is called…

Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…

A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…

Q: Use the sequence from the pre-mRNA shown below to answer the following question.…

A: Introduction :  The GU (5' splice site) and AG (3' splice site) recognise splice sites, signalling…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the…

A: During translation, the mRNA is read in triplets. The incoming tRNA reads the three bases at a time…

Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA

A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…

Q: Polycistronic mRNA are common in bacteria but seldom occur in eukaryotes. Describe the key…

A: mRNA which stands for messenger RNA is a molecule responsible for production of amino acid chain…

Q: Second base of codon U A G UCU Phenylalanine UAU UUU UGU Cysteine U Tyrosine tyr y UUC phe F UCC UAC…

A: A) The Adenine (A) is present in the intron or non-coding part of the gene, transcription results in…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…

A: Replication is the process of the formation of identical copies of DNA. It takes place in the…

Q: Use the following DNA sequence, and write the resulting messenger RNA sequence

A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…

Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…

A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.