Q: Antibiotic X binds to the 50S ribosomal subunit of 70S ribosomes and blocks normal ribosomal…
A: Introduction Antibiotics, also called antibacterials, are drugs that kill or slow the growth of…
Q: Why might some cells in the body, such as those in bonemarrow, be more susceptible to ribosomal…
A: Mutation It is the sudden heritable changes happening in the genotype of the organism which is…
Q: what ribosome channels accept charged tRNA molecules?
A: Large macromolecular structures known as ribosomes are present in every live cell. They are…
Q: Why and how does an antisense oligonucleotide functionally inactivate an mRNA for use in translation…
A: Antisense RNA (asRNA), also referred to as antisense transcript,natural antisense transcript or…
Q: Consider this list (below) of steps involved in translation. These steps are out of order.…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…
Q: What evidence supports the view that ribosomal RNAs are a more important component of the ribosome…
A: The discovery of ribozymes was the first indication of rRNA's importance (catalyze peptide- bond…
Q: Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also…
A: Hypothesis is basically a proposed explanation for any naturally occurring phenomenon in the…
Q: How does it improve the efficiency of protein synthesis to have several binding sites for tRNA close…
A: Translation is the process by which a protein is synthesized from the information contained in a…
Q: How the ribosome cannot do it's normal job in treacher Collins Syndrome disease?
A: Treacher collin syndrome is a genetic disorder or diseases that occurs due to the abnormalities in…
Q: Explain why prokaryotic ribosomes can translate a circular mRNA molecule, whereas eukaryotic…
A: Translation is the process by which ribosomes read the genetic code on the mRNA and synthesize…
Q: What is its functional difference with the RNA polymerases found in both eukaryotic and prokaryotic…
A: RNA polymerase is an enzyme that helps in DNA dependent RNA synthesis. RNA polymerase catalyzes the…
Q: Consider the following tRNAs, where the numbered forms represent the amino acids associated with…
A: Transcription is the process in which mRNA (messenger RNA ) is made from DNA which further…
Q: Why is it advantageous to have a mechanism to override the effect of stop codons in protein…
A: In the central dogma, the Ribonucleic acid (RNA) is formed from the template of Deoxyribonucleic…
Q: What is the major difference between bacterial ribosomes and eukaryotic ribosomes that makes it…
A: Prokaryotes are the organisms that possess primitive cellular organization such as bacteria. They do…
Q: Order the following choices to indicate the sequence of steps in the process of elongation of a…
A: The following are necessary for prokaryote polypeptide synthesis to begin: mRNA, the 30S ribosome…
Q: Why chaperones are particularly important when translation occurs on membrane-bound ribosomes ?
A: Protein translation either occurs in cytosol by free ribosomes and some proteins gets translated on…
Q: Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA…
A: Translation is the process of synthesis of protein from mRNA . So , RNA serves as a template . But ,…
Q: Match the following antibiotics with the drug strategy that would provide resistance to them.…
A: Rifampicin -mutation of the RNA POLYMERASE Rifamycin inihibts neither the binding of RNA polymerase…
Q: What is the functional role of modified bases for tRNA function
A: Transfer ribonucleic acid or tRNA It is a type of RNA molecule which is involved in decoding the…
Q: Describe the prokaryotic translation initiation shown in the diagram. Define the convention of…
A: In bacteria initiation factor are required .Initiation factor 3(IF3) prevents 30S subunit binding to…
Q: How do prokaryotic cells overcome the problem of a stalled ribosome on an mRNA that has no…
A: Translation is the process by which a protein is synthesized from the information contained in a…
Q: Which of these molecules has multiple partial charges and thus is most soluble in water? H H HHHH…
A: Most soluble in water.
Q: i)Describe a strategy for regulation of transcription in eukaryotes. ii)Explain how this strategy…
A: Transcription: The process of formation of the RNA transcript from DNA template by the enzyme DNA…
Q: For the given mutation below,please write down the reverse mutation and any intragenic suppressor…
A: Reverse mutation It is the mutation which denotes the mutational process that restores the wild type…
Q: How would a null mutation in the guanylyl transferase gene affect overall mRNA stability in…
A: RNA guanylyltransferase is known as a capping enzyme. It catalyzes the transfer of GMP from GTP to…
Q: What enzyme catalyzes protein synthesis in bacteria? You discover a new broad-spectrum antibiotic…
A: AS per the guidelines, first question is answered. a.The translation is the process where the RNA…
Q: Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation…
A: mRNA is translated to form protein. mRNAs contain trinucleotides sequences that code for particular…
Q: Part A Shown above is a schematic diagram of the E. coli leader peptidase (Lep) which has several…
A: In the membrane protein orientation studies, the "inside-positive" rule says that positively charged…
Q: Order the following choices to indicate the sequence of steps in the process of elongation of a…
A: The process of translation involves the synthesis of polypeptide chain and proceeds in three stages:…
Step by step
Solved in 2 steps
- What is the major difference between bacterial ribosomes and eukaryotic ribosomes that makes it possible to target bacterial ribosomes without harming our own cells?Below is an electron micrograph illustrating the process of simultaneous transcription and translation in a prokaryotic cell. Use this illustration to answer the question. A. Which of the following statements is correct? 1. The direction indicated by A, is the correct direction of RNA polymerase movement. 2. If C and D are both pointing to the first ribosome in the chain, then ribosome C is carrying a longer polypeptide chain. 3. If E is pointing to mRNA, then it is pointing to the 5'end of the mRNA. 4. If B is pointing to the DNA, then it is pointing to the 5' end of the DNA. O A. 1, 2 and 3 O B. 1 and 3 O C. 2 and4 O D. 4 only O E. All of 1, 2, 3 and 4 are correctWhy is the ErbB family pathway an important pathway for researchers that target cancer therapy. explain in 3-5 sentences.
- Are these true or false answers correct? If so, what is the proper word to replace the underlined words, for the false.Which of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water PhotophosphorylationHow do prokaryotic cells overcome the problem of a stalled ribosome on an mRNA that has no termination codon? How do eukaryotic cells solve this problem?
- Match the following antibiotics with the drug strategy that would provide resistance to them. rifampin which blocks transcription [ Choose ] Choose] tetracycline which misaligns the beta-lactamase anticodon to its codon mutation of the TRNA binding site of the ribosome penicillin which blocks peptidoglycan creation of alternate metabolic pathway that ultimately leads to the same product synthesis mutation of RNA polymerase polymyxin which causes leakage in the porin which removes drug from periplasmic space cell membrane sulfonamide which inhibits enzyme of [Choose ] folic acid synthesis pathway Question 14 2 pts % & 5 7Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'Part A Shown above is a schematic diagram of the E. coli leader peptidase (Lep) which has several basic amino acids in a cytoplasmic loop. Propose a mutant of Lep that would be a test of the "inside positive" rule for the orientation of proteins in membranes. Match the words in the left column to the appropriate blanks in the sentences on the right. Make certain each sentence is complete before submitting your answer. terminal reversed same (+) (-) center 1. Make mutant Lep that substitutes noncharged residues for the chains in the loop, and put charged side chains in 2. If the inside-positive rule applies, the mutant ought to have the membrane. Reset Help charged side positions. orientation in the
- what ribosome channels accept charged tRNA molecules?Order the following choices to indicate the sequence of steps in the process of elongation of agrowing peptide chain. a. release of EF1-GDPb. EF2-GTP hydrolysis promotes translocation of the ribosomec. peptidyltransferase reaction catalyzed by large rRNA subunitd. aminoacyl-tRNA binds the ribosomal A site via EF1-GTP hydrolysisi)Describe a strategy for regulation of transcription in eukaryotes. ii)Explain how this strategy is different than what might be used by a prokaryote.