Match the following antibiotics with the drug strategy that would provide resistance to them. rifampin which blocks transcription [Choose] [Choose ] tetracycline which misaligns the beta-lactamase anticodon to its codon mutation of the TRNA binding site of the ribosome penicillin which blocks peptidoglycan creation of alternate metabolic pathway that ultimately leads to the same product synthesis mutation of RNA polymerase polymyxin which causes leakage in the porin which removes drug from periplasmic space cell membrane sulfonamide which inhibits enzyme of [Choose ] folic acid synthesis pathway Question 14 2 pts 7 8 de 5

Match the following antibiotics with the drug strategy that would provide resistance to them. rifampin which blocks transcription [Choose] [Choose ] tetracycline which misaligns the beta-lactamase anticodon to its codon mutation of the TRNA binding site of the ribosome penicillin which blocks peptidoglycan creation of alternate metabolic pathway that ultimately leads to the same product synthesis mutation of RNA polymerase polymyxin which causes leakage in the porin which removes drug from periplasmic space cell membrane sulfonamide which inhibits enzyme of [Choose ] folic acid synthesis pathway Question 14 2 pts 7 8 de 5

Name: Match the following antibiotics with the drug strategy that would pro
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Match the following antibiotics with the drug strategy that would provide resistance tothem.rifampin which blocks transcription[ Choose ]Choose]tetracycline which misaligns thebeta-lactamaseanticodon to its codonmutation of the TRNA binding site of

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 12P

See similar textbooks

Similar questions

Antibiotic X binds to the 50S ribosomal subunit of 70S ribosomes and blocks normal ribosomal function. Which of the following is true of this drug? It would interfere with protein synthesis in bacteria, but not affect eukaryotic ribosomes. It would interfere with peptidoglycan syntheis/repair in bacteria, but not affect eukaryotes as they lack peptidoglycan. It would interfere with mRNA transcription in bacteria and in eukaryotes. It would interfere with protein synthesis in bacteria and eukaryotes. It would interfere with mRNA transcription in bacteria, but not affect eukaryotic transcription. It would interfere with peptidoglycan syntheis/repair in bacteria, as well as in eukaryotes that possess cell walls.
Which of the following would be a good chemotherapy approach: blocking formationof the ribonucleotide GTP or blocking formation of the deoxyribonucleotide dGTP?Why? Please explain the chemical differences between each of the two nucleotides. Use the specific processes below to support your choice by explaining how either GTP or dGTPare related to these and how loss of the particular molecule would affect each process. *PEP carboxykinase in gluconeogenesis*Succinyl-CoA synthetase in the TCA Cycle*Glucagon signal transduction
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
Azidothymidine is a Thymidine analog used to inhibit viral reverse transcriptase. Explain the application of this nucleoside analog as an antiviral drug and how it affects reverse transcription and therefore block the ability of the virus to hijack the host cell
In the: The 6 factor that does not dissociate from the RNA polymerase Holoenzyme Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?
In the: A mutated TBP protein Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?
Contrast the functions of Spo11 and Cas9, twoenzymes that catalyze the formation of doublestrand breaks
A peptidyl-tRNA in the P site has a strange modification with an ether versus an ester bond to the tRNA. When it is in the P site undergoing catalysis in the otherwise normal way, this molecule will become: More susceptible to the nucleophilic attack A better nucleophile O Less susceptible to the nucleophilic attack A worse nucleophile
Linezolid is a new type of antibiotic that inhibits protein synthesis in several bacterial species by bindingto the 50S subunit of the ribosome and inhibiting its ability to participate in the formation of translationalinitiation complexes. Physicians are particularlyinterested in this antibiotic for treating pneumoniacaused by penicillin-resistant Streptococcus pneumoniae (also called pneumococci). To explore themechanisms by which pneumococci can developresistance to linezolid, you first want to identifylinezolid-resistant strains. Next, using one of thesestrains as starting material, you want to identifyderivatives of these mutants that are no longertolerant of linezolid.a. Outline the techniques you would use to identifylinezolid-resistant mutant pneumococci andlinezolid-sensitive derivatives of these mutants.In each case, would your techniques involve directselection, screening, replica plating, treating withmutagens, or testing for a visible phenotype?b. Suggest possible…
CTP synthetase catalyzes the glutamine-dependent conversion of UTP to CTP. The enzyme is allosterically inhibited by the product, CTP. Mammalian cells defective in this allosteric inhibition are found to have a complex phenotype: They require thymidine in the growth medium, they have unbalanced nucleotide pools, and they have an elevated spontaneous mutation rate. Explain the likely basis for these observations.
Rifamycins have been used for the treatment of many diseases, including HIV-related Tuberculosis. Explain how Rifamycins inhibit the activities of bacterial DNA dependent RNA polymerase.
Would you expect actinomycin D to be a competitive inhibitor of RNA polymerase? What about cordycepin? Briefly explain your answers.