help QUESTION 2Which of the following pairs of tRNA antiqodons is most likely to be used in translation to produce thisdipeptide:NH2...His - Gln...COOH.O 5'IUG & 5'CUG5'GUG & 5'GUU5'GUI & 5'GỤC5'GUG & 5'UUG

Polypeptide synthesis relies on a constant supply of tRNAs that are charged with 20 amino acids.…

Answered: QUESTION 2 Which of the following pairs…

QUESTION 2 Which of the following pairs of tRNA antiqodons is most likely to be used in translation to produc dipeptide: NH2...His - Gln...COOH. O 5'IUG & 5'CUG 5'GUG & 5'GUU 5'GUI & 5'GỤC

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Question 7 The extent to which a given gene is transcribed depends upon (A the single transcription factor bound to the transcription start site (B the combination of translational factors bound to its upstream regulatory elements the particular combination of transcription factors bound to its upstream regulatory elements D the particular combination of transcription factors bound to its downstream regulatory elements
Question 11 Given this MRNA strand: 3' - AUGAGGAAGGUA - 5'; what are the components of the polypeptide? First Position Third Position (3' end) (5' end) U A G UGU Cys UUU Phe UUC Phe UCU Ser UCC Ser UCA Ser UAU Tyr UAC Tyr UAA Stop UAG Stop |U UGC Cys UUA Leu UUG Leu UGA Stop |A UGG Trp U G CGU Arg CGC Arg CGA Arg UCG Ser CAU His САС His CAA Gln CAG Gln CUU Leu CCU Pro U ССС Pro CỤC Leu CỦA Leu CUG Leu CCA Pro A CCG Pro CGG Arg G U AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu AUU Ile ACU Thr АСС Thr ACA Thr ACG Thr AGU Ser AUC Ile A AUA Ile AGC Ser AGA Arg A AUG Met* AGG Arg G GUU Val GGU Gly GCU Ala GCC Ala GCA Ala GCG Ala U GGC Gly GÚC Val G GUA Val GGA Gly |A GUG Val GGG Gly G
QUESTION 21 Suppose the following are sequences at the 5' splice junction and the 3' splice junction, with intervening intron sequences shown as dashes and the branchpoint A shown, not surprisingly, as 'A'. What is the sequence formed after splicing? 5'-CUCAAUGGUACA- -----CGAUACGAGCACUGACC-3' O A. 5' CUCAAUGCACUGACC 3' O B. 5' CUCAAUGACC 3' O C. 5' CUCAAUGGGCACUGACC 3' O D. 5' CUCAAUGGUGACC 3' O E. 5' CUCAAUGGUACACGAUACGAGCACUGACC 3'
Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect. (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)
Question 7. What are the first three amino acids in the protein that is produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGATGGCTAGT... 3' 3' СТААGGCAТААTGTCGTATСCGATATAAGTGCACCTАCCGAТСА. .. 5' Start site
Question 5. AP1 is a transcription factor and an important regulator of gene expression and cell proliferation. Dysregulation of AP1 function may lead to cancer. The fos gene codes for AP1. Below is an experiment in which the role of a micro‐RNA (miR‐7b) in the regulation of fos gene expression was studied. miR‐7b shows partial sequence complementarity to the 3′‐untranslated region of fos mRNA. A DNA fragment coding for miR‐7b RNA and another fragment coding for a micro‐RNA unrelated to fos mRNA were cloned into vectors, and the recombinant plasmids (designated si‐miR‐7b, samples 3 and 4, and si‐miR‐neg, samples 5 and 6, respectively, in Fig. 1) were introduced into mouse fibroblast cells. Non-transfected cells were used as controls (samples 1 and 2). Samples 2, 4, and 6, were treated with a chemical PMA that induces transcription of fos gene; samples 1, 3, and 5 were left untreated. Two hours after PMA treatment protein extracts were prepared from the cultures and were then…
QUESTION 8 Consider the pathway for the synthesis of the amino acid arginine in Neurospora: ARG-E → citrulline ARG-F ARG-H ornithine argininosuccinate arginine Mutant strains of Neurospora may carry one or more mutations. Neurospora mutant strain b is grown on minimal media plus supplements as shown. Growth is shown by (+) and no growth is shown by (o). Supplements ornithine mutant nothing citrulline arginino- succinate arginine strain What can you conclude from these data? O Strain a has only one mutation and it is in ARG-E. O Strain b has only one mutation and it is in ARG-H. O Strain a has a mutation in ARG-F and strain b has a mutation in ARG-E. O Strain b has mutations in ARG-E, ARG-F, and ARG-H. + +
Question 4 TRUE or FALSE Phosphorylated CTD of [ Choose ] RNA Pol recruits guanylyl transferase Prokaryotes have higher MRNA relative stability than eukaryotes. ( Choose ] In RNA silencing, AGO [ Choose] acts as a helicase to precursor miRNA. * Previous Ne
QUESTION 7 UUUUU..3' Rho-independent (intrinsic) terminators in bacterial transcripts consist of a sequence that forms a "hairpin" stem-loop structure, followed in the direction of transcription by a polyuridine (polyU) sequence, as shown in the figure above. Which of the following template strand DNA sequences, when transcribed, will form a terminator structure in the transcript? 5 CCGACGTATCCGACGTTTTTTTT3' 5'AAAAAAAACCGACGTATCGTCGG3' 5 CCGACGTATCGTCGGAAAAAAAA3' 5 TTTTTTTTCCGACGTATCGTCGG3' 5 AAAAAAAACCGACGTATGCAGCC3'
Question 7 A unique 5'CCA terminal sequence is found in all RNAS to be able to carry the correct amino acid to the ribosome. A True B) False
Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATT CA CGTGGATGGTCAGTA... 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCTACCGATCAT... 5' Start site
Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 3' 5' GATTCCGTATTACAGCATAGGCTATATT CACGTGGATGGTCAGTA... 3' CTAAGGCATA ATGTCGTATCCGATATAAGTGCACCTA CCGATCAT... 5' Start site