Thx The following prokaryotic DNA is transcribed into RNA and the mRNA transcript is translated intoprotein.141ATGGGTTACTA Convert JPG to PDF...81AGTATGGGTA121takeACGTATGCATTTTTTTTTTC64-129O 71-119O 1-131O 54-11911ATGAGGAGTT51Pt Periodic Table - Pta...TAATCTAATG91SU My ASU13121GACACACAAGData Access Requir...6131CGTAATTGAG101AGGAGGTAGCAGATAACGTA CGGGGGGGAA ACCCCCCCTT141Resume Now71Useful sequences: -35: 5' TTGACA 3',-10: 5' TATAAT 3' (Pribnow box), Shine Dalgarno sequence: 5'AGGAGGU 3'What region of this prokaryotic DNA sequence will be transcribed into mRNA?GAGGTAGTTG111GAGCAATAAA AGGGTTACAG

The central dogma of molecular biology tells us how the genetic information is stored within a cell,…

The following prokaryotic DNA is transcribed into RNA and the mRNA transcript is translated into protein. 1 ATGGGTTACT 41 AGTATGGGTA 81 ACGTATGCAT 121 ert JPG to PDF... TTTTTTTTTC 64-129 O 71-119 O 1-131 O 54-119 11 ATGAGGAGTT 51 Pt Periodic Table - Pta... TAATCTAATG 91 AGATAACGTA 131 21 ASU My ASU 61 GACACACAAG AGGAGGTAGC 71 Data Access Requir... GAGCAATAAA 31 Useful sequences: -35: 5' TTGACA 3',-10: 5' TATAAT 3' (Pribnow box), Shine Dalgarno sequen AGGAGGU 3' What region of this prokaryotic DNA sequence will be transcribed into mRNA? Resume Now CGTAATTGAG GAGGTAGTTG 101 111 CGGGGGGGAA ACCCCCCCTT 141 AGGGTTACAG

The following prokaryotic DNA is transcribed into RNA and the mRNA transcript is translated into protein. 1 ATGGGTTACT 41 AGTATGGGTA 81 ACGTATGCAT 121 ert JPG to PDF... TTTTTTTTTC 64-129 O 71-119 O 1-131 O 54-119 11 ATGAGGAGTT 51 Pt Periodic Table - Pta... TAATCTAATG 91 AGATAACGTA 131 21 ASU My ASU 61 GACACACAAG AGGAGGTAGC 71 Data Access Requir... GAGCAATAAA 31 Useful sequences: -35: 5' TTGACA 3',-10: 5' TATAAT 3' (Pribnow box), Shine Dalgarno sequen AGGAGGU 3' What region of this prokaryotic DNA sequence will be transcribed into mRNA? Resume Now CGTAATTGAG GAGGTAGTTG 101 111 CGGGGGGGAA ACCCCCCCTT 141 AGGGTTACAG

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Related questions

Q: What is herv?

A: These are endogenous viral elements present in the genome that closely resemble retroviruses. It…

Q: 4 Label the dingm ing plan nd body potion teilgy Calar the pium acingt the ly pded in the le belew…

A: Introduction: Anatomy is that branch of medical science that describes the location and structure of…

Q: A -J B -E -K

A: In most vertebrate animals, a bone is a hard tissue that forms part of the skeleton. Bones protect…

Q: trigers angina pectoris

A: Angina Pectoris is a type of chest pain.

Q: to treat a thyroid tumor

A: The cellular growth that occurs when the cells divide uncontrollably is known as cancer. It arises…

Q: paralectotype

A: Introduction Zoology is a branch of biology that focuses on the study of animals, including their…

Q: Bleeding, abnormal excessive fluid discharge Ending -ostomy

A: Ostomy causes a change in the way urine or stool exits the body as a result of a surgical procedure.…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: RrYy X RrYy

A: RrYy X RrYy Parent 1= RrYy Parent 2= RrYy Gene 1 Alleles=Rr Gene 2 Alleles=Yy

Q: В

A: All the 3 diagrams/ structures given are containing theCOOH group and a C-H backbone that's the…

Q: What is a concussion

A: Nursing care is the field of clinical practice of administration of drug ,patient counselling and…

Q: bleeding internally

A: It means that the blood vessels are damaged inside the body which leads to extravasation of blood…

Q: 6. Contrast what is going on with the bacteria at arrow A with those at B. As you discuss your…

A: Bacterial resistance refers to the ability of bacteria to survive and grow in the presence of…

Question

Thx

The following prokaryotic DNA is transcribed into RNA and the mRNA transcript is translated into
protein.
1
41
ATGGGTTACT
A Convert JPG to PDF...
81
AGTATGGGTA
121
take
ACGTATGCAT
TTTTTTTTTC
64-129
O 71-119
O 1-131
O 54-119
11
ATGAGGAGTT
51
Pt Periodic Table - Pta...
TAATCTAATG
91
SU My ASU
131
21
GACACACAAG
Data Access Requir...
61
31
CGTAATTGAG
101
AGGAGGTAGC
AGATAACGTA CGGGGGGGAA ACCCCCCCTT
141
Resume Now
71
Useful sequences: -35: 5' TTGACA 3',-10: 5' TATAAT 3' (Pribnow box), Shine Dalgarno sequence: 5'
AGGAGGU 3'
What region of this prokaryotic DNA sequence will be transcribed into mRNA?
GAGGTAGTTG
111
GAGCAATAAA AGGGTTACAG

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Transcription and translation are localized processes

VIEW

Answer with explanation

VIEW

Why transcription stops at nucleotide 129 here ?

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?
Contrast transcription and translation. Name at least three differences between the two processes.
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Put the following processes in order of their occurrence during expression of a eukaryotic gene: a. mRNA processing c. transcription b. translation d. RNA leaves nucleus
A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.
How many kilobases of the DNA strand below will code for the protein product?
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).