Q17. In a dog breed, a gene B coding for fur color has a dominant allele B for black fur. Gene B has a recessive allele b that produces brown fur. A second gene I, has a dominant allele I that is epistatic to the color locus and can inhibit pigment formation. Gene I has a recessive allele, i, on that permits pigment deposition in the fur. Note: the inhibition of pigment formation by the epistatic allele I causes the fur to be white. A) What is the phenotype of the individuals with the below genotypes? bbii Bbli Bbii bbli BBIi B) What are the phenotypes and genotypes of the offspring of each of these dog crosses? a. bbii x Bbli b. bbii x Bbii c. bbli x BBli C) What type of epistasis is described in this problem?

Q: What are the common long-term sequelae of stroke, and how are they managed?

A: A stroke happens when the blood supply to a piece of your cerebrum is hindered or diminished,…

Q: QUESTION 8 Which of the following is true of the RAS proto-oncogene? O Mutations involving RAS are…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: The difference in phenotype between pups 2 and 3 (black progeny) can be explained as moderately…

A: Phenotype  The appearance of an organism is known as phenotype. The phenotype of an organism is the…

Q: If a rabbit with the defective gene is not fed plants with the pigment, what color is its fat? Can…

A: As provided with the information that rabbit with active form produce white-colored fat and those…

Q: 5. In the California Poppy, an allele for yellow flowers (C) is dominant over an allele for white…

A: Punnett squares represent a foundational tool within classical genetics, commonly harnessed to…

Q: The differential expression of alleles depending on whether they are maternally or paternally…

A: Hi, Thanks For Your Question.  Answer : Correct Option Is 1 (Genomic Imprinting).

Q: 38. The onset of Ventricular systole is associated with: A. the closing of the aortic valve B. the…

A: Heart is the pumping organ. It is responsible for pumping the blood to different parts of the body.

Q: nheritance of one mutant allele of BRCA1 is associated with 70-80% lifetime risk of developing…

A: BRCA1 is a tumor suppressor gene inactivation leads to breast cancer.

Q: 11. Choose from the following types of inheritance and write in the 1" column which one is described…

A: Please follow step 2 for a detailed explanation of the inheritance mode of the given situations.

Q: Part 3C: Below is data from a pedigree trace of patients affected with mouse model of pancreatic…

A: Answer  The mode of inheritance shown in the above pedigree is of autosomal recessive

Q: In a wildflower species, flowers occur in three colors: orange, red, and white. The color is…

A: It is given that the T- encodes white color. Whereas RR or Rr encodes red color in presence of tr…

Q: What  type of mutation occurred in the gene sequence that resulted in white-fur bears

A: Polar bears have white fur to help them blend in with their surroundings. In Arctic conditions,…

Q: Diseases which are caused by recessive variants in loci located on the X chromosome affect females…

A: ( Comment: As per the guidelines,we are allowed to answer one question at a time, so repost second…

Q: Polydactly is an autosomal dominant phenotype. In this pedigree, I-2 has one copy of the dominant…

A: A condition in which a baby is born with one or more extra fingers is known as polydactyly. It's a…

Q: i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at…

A: The transcription unit has a coding strand and template strand. Out of these two strands, only the…

Q: Ms. Biñas is a plant lover. She amused herself by often seeing those beautiful greeneries with…

A: The phenotypic traits in organisms are controlled by genes. A gene can exist in many different forms…

Q: 5) Scale color in dragons is determined by two genes. The W gene is epistatic to the G gene. The W…

A: Epistasis is also known as non allelic interaction.  It does not follow Mendel's laws.

Q: 1. If there were only two alleles of TAS2R38 (AVI and PAV) in the human population, what are the…

A: The first part of the question is asking about the possible combinations of two alleles, AVI and…

Q: 6. Assuming no crossing over occurs between the Huntington gene and th develop Huntington Disease?…

A:

Q: Bombay effect.

A: The Bombay effect is a phenomenon depicted by the H antigen, which is responsible for the expression…

Q: In Labrador retrievers fur color is controlled by two genes. One gene controls pigment production…

A: The coat color in Labradors is controlled by two genes; one responsible for producing the pigment…

Q: In lizards, the mutants green skin (g) and flaky legs (f) are both recessive and assort…

A: The chi-square analysis was utilized to test that alleles that are segregating based on Mendelian…

Q: A red flowered plant was crossed with a blue flowered plant and produced all purple flowered plants.…

A: (a). Number of phenotypes in a polygenic trait…

Q: blood cell surface protein that is glycosylated by products of the I gene with alleles IA, IB and/or…

A: In order to determine the blood types of the children we need to first analyze the genetics of the…

Q: Epistasis: 1) In violets, purple flower color (P) is dominant over white (p), but there is also a…

A: Epistasis is a condition in which the expression of one gene is affected by the expression of one or…

Q: . Neurofibromas are tumors of the skin that can arisewhen a skin cell that is originally NF1+/ NF1−…

A: It is given that neurofibromas are skin tumors that can occur when a skin cell that is originally…

Q: Explain the expression configurational induction. Use a specific example to explain it and draw the…

A: In embryology, induction is the process through which one tissue influences the development of…

Q: A mutation on an autosome causes a particular protein to be overproduced, and the excess protein…

A: Given that a gene have undergone a mutation in autosomal such that it starts over producing a…

Q: 8-10: In gerbils, the allele for long tail (7) is dominant to short tail (†). If two heterozygous…

A: Note: As Per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Law…

Q: A male fish from a true-breeding fish line has the mutant phenotype of spiky fin. The male fish…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: A recessive mutation pd causes purple eyes in Drosophila, in contrast to the wildtype red eyes. A…

A: The objective of this question is to determine the proportion of offspring that will have purple…

Q: In Mendel's genetic experiments many characteristics of the plants were quantified, such as their…

A: Genetics is the branch of biology that studies how traits are passed down from one generation to the…

Q: Expression levels of GeneA and GeneB were measured in 10 cell lines. The researcher would like to…

A: There are several genes in the organism that are expressed at different rates at different times.…

Q: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG…

A: A mutated sequence can fail to produce a functional protein due to formation of a non-sense codon or…

Q: The gene known to be mutated in cases of Agammaglobulinemia 2 (which is inherited in an autosomal…

A: A rare hereditary condition that affects the immune system is agammaglobulinemia. The illness is…

Q: Which of these statements will corroborate (confirm) known information pertaining to alleles? OA In…

A: When the dominant allele of one gene hides the expression of all alleles of another gene, this is…

Q: In mice, the A allele causes agouti fur, the AY allele causes yellow fur and is dominant to the A…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: a. For the E.coli haploid genotype below, determine the phenotype for the following proteins. Assume…

A: Lac operon Lac operon or the lactose operon is a gene expression system in E Coli. and many similar…

Q: You are interested in studying position effect variegation in Drosophila using the chromosome…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Which of the following is most influenced by the SRY gene?

A: Introduction  Chromosomes are classified into two types: Autosomes and Allosomes/Sex chromosomes.…

Q: a) b) Determine the F₁ and F2 phenotypes from a cross between AABBccDDEE and AABBCCDDee plants. What…

A: Polygenic traits such as skin color, flower color, etc are controlled by two or more two genes. The…

Q: 10. Fur colour in mice is an example of the effects of interaction between different genes. Wild…

A: A Punnett square is a diagram used to predict the probability of offspring genotypes resulting from…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.