In mice, the A allele causes agouti fur, the AY allele causes yellow fur and is dominant to the A allele. The homozygous AY AY genotype is lethal.   Why is the AYAY homozygous condition lethal?   The yellow pigment produced by A allele is required for survival. The AY allele lacks an upstream merc gene which is required for normal embryonic development. The AY allele highly transcribes the merc gene which is lethal in a homozygous AYAY individual. The AY allele contains a null mutation in the A gene, which is required for normal embryonic development. None of the other answers are correct.

Q: a. In which sex, XY males or XX females, would the Sxl protein bind to the msl-2 mRNA? b. As…

A: Drosophila sex determination and dosage compensation are primarily controlled by two distinct sets…

Q: Please answer  A mutation within an enhancer sequence regulating the expression of the ABC1 gene…

A: The transcription is the process by the RNA is produced from the DNA and this is the first step of…

Q: The CTCF protein is involved in the regulation of the Igf2-H19 gene cluster. Which of the following…

A: The gene expression involves transcription and later translation. Different mechanisms are involved…

Q: You found a strain of mutant fruit flies (Drosophila) living on the rotten bananas in your dorm…

A: Maternal effect genes are influencing the development of an embryo when transferred in the form of…

Q: Why are diseases due to microsatellite amplification, even though they have a monogenic pattern of…

A: The classical inheritance is the type of inheritance pattern in which mendelian laws are followed…

Q: Give at least 3 examples each of internal and external factors that affect penetrance and…

A: Penetrance is a term used to define whether or not a genotype has a clinical expression in a person.…

Q: The b1 allele encodes a transcription factor that stimulates production of anthocyanin, a purple…

A: It is given that seven tandem repeats were deleted that are located 100,000 bp upstream of the b1…

Q: A protein or RNA that regulates gene expressionin trans—either at the level of transcription,…

A: Trans-acting factors include proteins and RNAs that regulate gene expression in an organism. Their…

Q: Explain

A: The process by which information encoded in a gene is used to control the assembly of a protein…

Q: Explain the importance of differential gene expression. Why don't cells and organisms simply express…

A: Gene expression is the process by which a gene's information is used to create a functional gene…

Q: Let’s suppose an X-linked gene in mice exists as two alleles, whichwe will call B and b.…

A: The females contain two copies of X chromosomes. These copies are derived from the maternal and…

Q: Would the pattern of segment-polarity gene expression be normal if one or more gap genes were not…

A: Segment polarity are required for patterning within each embryonic segment and mutations in genes…

Q: Epigenetic markers tell your genes to switch on or off. What are two environmental factors that can…

A: While most environmental exposures affect somatic cells and do not allow for transgenerational…

Q: afa Q a/a Q Unsupplemented Supplemented b A"/a offspring Unsupplemented mother Supplemented mother…

A: Given information The cross involved is Awa x aa. One group of offspring with supplemented mother…

Q: Given a mutation in the promoter, coding region, and/or non-coding region of a gene, explain how…

A: The mutation is a sudden heritable change in the genetic makeup of a cell which mostly results in…

Q: The phenotype of a heterozygous mouse (Aa) is agouti.  The agouti banding pattern is due to altered…

A: * Homozygous dominant and Heterozygous will produce agouti that is AA or Aa respectively  and the…

Q: Determine the correspondence of the gene X and gene Y to the mutant gene causing Trp-phenotype

A: An organism's genotype is influenced by its genome as well as by its environment. The physical…

Q: Using this information annotate the diagram.

A: Transgenic plants: Transgenic plants are those plants, which carry additional, stably integrated and…

Q: Pax-6 is a gene that is involved in eye formation in many invertebrates, such as Drosophila. Pax-6…

A: Genes are the units of heredity, in other words, we can say genes are the short nucleotide sequences…

Q: The GAL4 expression system can be used to experimentally induce expression of a gene in a specific…

A: INDUCED EXPRESSION - Inducible expression systems are essential molecular tools for the production…

Q: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG…

A: A mutated sequence can fail to produce a functional protein due to formation of a non-sense codon or…

Q: times of nutrient stress, the cellular slime mold Dictyostelium discoideum develops one of two cell…

A: Dictyostelium discoideum is a species of soil-dwelling amoeba belonging to the phylum Amoebozoa,

Q: Determine the correspondence of the gene X and gene Y to the mutant gene causing Trp-phenotype

A: An organism's genotype is influenced by its genome as well as by its environment. The physical…

Q: gene 2 seems to be expressed at higher levels than gene 5. Justify the claim that the two genes have…

A: The process by which a cell produces molecules based on the direction of the DNA is called the…

Q: Which of the following is most influenced by the SRY gene?

A: Introduction  Chromosomes are classified into two types: Autosomes and Allosomes/Sex chromosomes.…

Q: Which tissue in the human body is the CFTR gene most expressed?

A: Introduction The CFTR gene encodes a membrane protein and chloride channel in vertebrates called…

Q: Describe the difference in the effects of a mutation in a gap gene versus one in a pair-rule gene.

A: The genes consist of hereditary information in the deoxyribonucleic acid (DNA) sequences and is…

Q: When the expression of alleles are affected by the presence of other genes,such as sickle cell trait…

A: If a person is a carrier of sickle cell anemia then half of the RBC of the individual are…

Q: Use the dropdowns to indicate the pattern of methylation and gene expression expected for a…

A: Here's a breakdown of the key points:Somatic cell inheritance: Somatic cells inherit one allele from…

Q: The human body contains many distinct cell types yet almost all human cells contain the same genome…

A: The human body contains many distinct cell types yet almost all human cells contain the same genome…

Q: In the fX174 genome, describe the difference between how thegene B and gene A* proteins are made

A: fX174:- Craig venter and his group reported the genome of fX174 in in-vitro conditions. It is a…

Q: In a haploid, a nonsense suppressor su1 acts on mutation1 but not on mutation 2 or 3 of gene P. An…

A: In a procedure known as synthetic rescue, a suppressor mutation is a second mutation that alleviates…

Q: Describe the mechanism of genomic imprinting of the Igf2 gene in mammals.

A: Genomic imprinting is an epigenetic form of gene regulation. This results in the function of only…

Q: Geneticists have been exploring ways to suppress the expression of the extra chromosome 21 in…

A: Chromosomes are a compact form of DNA wrapped around some proteins and are generally present in a…

Q: A mutation occurs in the Drosophila doublesex gene that prevents Tra from binding to the dsx RNA…

A: Any alternation in the sequence of nucleotide in the genome of any organism is said to be mutation.…