a. For the E.coli haploid genotype below, determine the phenotype for the following proteins. Assume that any genes or structural elements not shown are wildtype. lacls lacZ lacY* lacz uninducible lacY uninducible

Q: linkage disequilibrium

A: a) Linkage:  Linkage is the phenomenon of certain genes staying together during inheritance…

Q: Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…

A: Translation is the process which is responsible for synthesis of protein from the mRNA.

Q: . One way to determine where inside a cell a protein(protein X) normally localizes is to generate a…

A: The X-GFP gene can be produced by knocking in the coding sequences of GFP as compared to random…

Q: Describe the banding pattern seen in the gel. What does that tell you about the role of annealing…

A: Gel electrophoresis is a laboratory technique for separating charged molecules such as DNA, RNA, and…

Q: A 210-bp sequence within the CFTR gene on human chromosome 7 is shown below. The three bold…

A: A primer is a short DNA sequence that serves as a starting point for DNA synthesis in a polymerase…

Q: Briefly discuss why mutant allele 1 fails to produce functional protein. Note that this mutation has…

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: The chromosomal sequences of two mutant alleles of gene A from patients with the zero subtype…

A: DNA is the genetic material. An alteration in the DNA sequence of an organism by the substitution or…

Q: onsider the following 4 regulatory pathways (recall arrows are activators and blunt ends are…

A: Genetics means the study of gene and heredity. A gene is the structural and functional unit of…

Q: A mutant is found that has the following protein sequence in that part of the protein: Tyr Lys Gly…

A: Amino acids are represented by codon. Each codon is made up of three nucleotide bases. A codon can…

Q: lactose is present in a cell with the following genotype, will functional Beta – galactosidase…

A: Lac operon is used by Ecoli to metabolize lactose when glucose is not available  It produces beta…

Q: Discuss inheritance. Think broadly on inheritance patterns through generations. What impact do…

A: In genetics, hereditary unit can be described as a gene that is present on chromosomes. The genes…

Q: éxpressed by the genome. Proteomic analysis indicates that human cells are capable of synthesizing…

A: Gene expression means the protein which are going to be formed by the gene by the process of…

Q: a. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation…

A: ρ-dependent is basically a translation termination mechanism occuring in prokaryotic cells. Here ρ…

Q: If a SNP is found much more frequently in dogs with white fur than in dogs with black fur, the SNP…

A: Single nucleotide polymorphisms (SNPs) in GWAS are essential for understanding the genetic…

Q: Describe how polymorphisms is found at 13910-C/T and 22018-G/A in the regulatory area of the lactase…

A: Lactose is the main sugar in milk, which is a disaccharide. It is hydrolyzed by intestinal lactase…

Q: What is a haplotype?

A: Single base pair changes in the DNA sequence such as deletions, insertions between two human genomes…

Q: Please answer fast Write two different partial diploid genotypes where Lac Z is produced…

A: The lactose operon is an example of inducible operon in which the expression of downstream genes…

Q: A complex biochemical pathway is shown below, along with the alleles that either promote or inhibit…

A: Metabolic pathways or biochemical pathways are a series of chemical reactions that occur within the…

Q: Based on the sensitivity of DNA to DNase I, as illustrated in Figure , which type of chicken…

A: Deoxyribonucleic acid (DNA) is the genetic material of the most of the organisms that carry coded…

Q: I know the answer is e but can you thoroughly explain the answer choices? like what does…

A: The prokaryotic gene regulation is known as operon system which regulates the transcription of a…

Q: A mutation on an autosome causes a particular protein to be overproduced, and the excess protein…

A: Given that a gene have undergone a mutation in autosomal such that it starts over producing a…

Q: A. A mutation is recovered in the gene that encodes the lactose operon repressor protein (LacI).…

A: Lac operon is a simple prokaryotic group of genes for the metabolism of lactose. It consists of…

Q: Annotation of the human genome sequence reveals a discrepancy between the number of protein-coding…

A: it occurs due to the RNA matration process and other modifications

Q: a. Why does a shift from grain to meat diets create more demand for cereals? b. What is the name of…

A: Cereals are the very important supple edible part of grain. The edible half is reproductive…

Q: Match the term with the correct description. satDNA                                  STRs…

A: INTRODUCTION Tandem repeats These are short segments of DNA that can repeat many times within a…

Q: How many of the mutations listed below would lead to excessive cell growth when the cell was either…

A: Excessive growth occurs when a cell continuously divides and when there is no cell cycle arrest. Myc…

Q: Recall that Leber congenital amaurosis (LCA), a formof congenital blindness in humans, can be caused…

A: Leber congenital amaurosis (LCA) is a form of congenital blindness in humans, which is caused due to…

Q: ompare the different electrophoretic data band patterns in the zymogram provided. How would you…

A: Ans: Zymograph or zymogram: This is the electrophoretic technique that is used to detect the…

Q: Here is one set of primers used to amplify a segment of this gene. Select the option that…

A: The polymerase chain reaction (PCR) is the in-vitro amplification of DNA using a…

Q: In Figure 12-4, certain mutations decrease the relativetranscription rate of the β-globin gene.…

A: A promoter is the region of DNA where transcription is initiated. It provides a site for binding of…

Q: Give correct typing answer with explanation

A: Cas9Spo11Both1. Functions in defense against bacteriophages - Cas9  - Cas9 is an enzyme that…

Q: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG…

A: A mutated sequence can fail to produce a functional protein due to formation of a non-sense codon or…

Q: . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: In molecular biology, a point mutation in DNA occurs when a single (two ring) purine (A or G) is…

Q: Although most cases of cystic fibrosis are inherited in an autosomal recessive manner, it is…

A: Inheritance is the process of transmitting the traits from parent to offspring. Traits of an…

Q: Gene Interaction and Epistasis Hair color is due to the presence of melanin. There are two types of…

A: Given information Melanin is responsible for hair color. Two types of melanin are; eumelanin and…

Q: . Where is this gene location in the bacterial genome? . What is the length of the gene? . Obtain…

A: Salmonella is usually found in the Gastrointestinal tracts of mammals

Q: in 3 5% Shown below is a schematic diagram showing a 3000 bp region of yeast genomic DNA. (Note:…

A: DNA:  The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic…

Q: Q. Telomere is a typical heterochromatic region in eukaryotic genome. Choose an incorrect…

A: Telomeres are the ends of chromosomes and contain repeated DNA that runs in 5′ to 3′ direction at…

Q: A double mutant produced by uneven crossing-over contains two single nucleotide mutations that…

A: The mRNA or messenger RNA contain the genetic codon that are translated into polypeptide chain by…

Q: functionalization of a sensor array with DNA oligonucleotide capture probes for ribosomal RNA (rRNA)…

A: (B)The method which is based on sandwich hybridization of a capture and a detector probes with…

Q: Determine which statements could be used as evidence to support the argument that “DNA influences…

A: Hemoglobin is made up of globin ptotein and heme group. Globin protein consists of four protein…

Q: . The human IGF2 gene is autosomal and maternallyimprinted. Copies of the gene received from…

A: It is given in the question that there are two alleles in the Igf2 gene, and it is maternally…

Q: Q. The nuclear membrane disintegrates late in prophase of mitosis in most eukaryotic cells. Once the…

A: DNA polymerase is found in the cytoplasm outside of the nucleus.  So we can say that options C, D,…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.