MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.

MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?
Which amino acid sequence will be generated? 5'-GAAUGUCUUCGUUAUUGAUGUAGAA-3'
The eukaryotic mature mRNA sequence will be translated into a polypeptide that is _____ amino acids long (hint remember to "be a ribosome" and scan for the AUG and look out for stop codons!). 5’-CCATTCAUGUUUGGUGGCUAACCA-3’
What aminos acid would the anticodon GAC be translated into? Please explain how you went about getting to the answer to the question.
Eukaryotic messenger RNA includes a poly A tail. When the poly(A) tail is less than approximately 30 nucleotides in length, explain why the messenger RNA no longer is protected from nuclease digestion.
First letter U U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine A AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG C Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC A CAA CAG Histidine Glutamine AAU AAC Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC GGU GGC AGA AGG Arginine GGA GGG AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC Arginine Serine Glycine Which mutation could result in the removal of a site for glycosylation or phosphorylation? DOAGUO AGUO AGUAG Third letter с
mRNA sequence of A gene Find start codon and stop codon 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart.
Which of the following polypeptides (written from their N terminal ends) is encoded by the following mRNA? (hint: there is no left or write in a cell!) 3' GG AUG AGU AUA CUU ACG GGU GAA GUA CAU UAA CCC C5' O O O Met Lys Trp Ala Phe lle Met Ser lle Leu Thr Gly Glu Val His Tyr Lys Arg Thr Phe Tyr Met none of the above His Val Glu Gly Thr Leu lle Ser Met
Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA that would translate the synthesis of the following pentapeptide:Arg · Ile · Cys · Tyr · Val
During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, II
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’