microRNAs (miRNAs) play important roles in gene regulation. What is the correct order of steps (using letters A - E) for miRNA biogenesis or formation? A. Synthesis of pri-miRNA B. Targeting of mRNA for translation repression or mRNA degradation C. Loading into RISC complex D. Formation of mature miRNA E. Formation of pre-miRNA O AECDB ο ο ο O CDAEB O ACBDE O ADCEB O ECABD

Q: 67 RNA interference was first discovered in Drosophila melanogaster. Yes or no 68 Which of the…

A:

Q: Where is the start codon located?

A: A sequence of three nucleotides on the mRNA strand is known as the codon. Each codon codes for the…

Q: 97 Which of the following is examples of a transposable element found in bacteria? (multiple choice…

A: Note- we are supposed to answer three question according to our guidelines, please repost other…

Q: An ncRNA may have the following functions: scaffold, guide,alterer of protein function or stability,…

A: ncRNA or non-coding RNAs, as the name suggests, are RNA molecules which do not code for…

Q: A particular mature miRNA (microRNA) in mice has sequence 5'-UUCCCUGAGACCUCAAGUGUGA-3'. a. If you…

A: Answer a) ii and iii ii) mRNA sequence complementary to the miRNA sequence iii) miRNA sequence with…

Q: Formation of the 70S ribosomal initiation complex for prokaryotic translation requires A. Mn2+ B.…

A: The production of proteins made up of amino acids is a step in the translation process in cells.…

Q: The RNA-induced silencing complex (RISC) _____ i. Binds to and unwinds ds siRNA/miRNA to produce…

A: The answet is b. II only RNA-induced silencing complex(RISC) is a multiprotein complex which…

Q: In unit 1 we learned about the CFTR gene that codes for a chloride channel that does not function…

A: Cystic Fibrosis (CF) is a genetic disorder that is caused by mutations in the CFTR gene. This gene…

Q: miRNAS P. are synthesized as long pri-miRNAs (up to 1000 nucleotides). Q. are transcribed by RNA…

A: Micro RNAs are found in animals, plants and some viruses. These are single stranded RNA molecule…

Q: What is the first step in the production of a siRNA? O infection with a virus O transcription from a…

A: Si RNA means small inhibitory RNA .

Q: The foloving dagram represents a transcription unit (a gene) and corresponding RNA transcripts being…

A: The piece of DNA that take part in transcription is called transcription unit. Transcription unit…

Q: How would you describe the "purpose" of alternative splicing? Alternative RNA splicing... is a…

A: Nucleic acid is a macromolecule present inside the nucleus of cell . It stores genetic material and…

Q: Which of the following is NOT true of miRNAs?   A. Pri-miRNAs are processed by Drosha in the…

A: A microRNA, also known as a miRNA, is a single-stranded, non-coding RNA molecule that is very small.…

Q: The following are examples of how eukaryotic cells may control gene expression small RNA molecules O…

A: The eukaryotic genome is huge and consists of millions of base pairs. It is highly packed in…

Q: In the figure below, what is represented by the line labeled A? TFIIB recognition element DNA in m…

A: Transcription of genes includes the formation of RNA using the template DNA. It includes the enzyme…

Q: aminoacyl-tRNA

A: 43 D third position   The wobble position of a codon refers to the 3rd nucleotide in a…

Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…

A: There are 4  codons that specify the amino acid valine, demonstrating the genetic code  is…

Q: The method of Northern blotting is used to determine the amountand size of a particular RNA…

A: A gene is a stretch of nucleotides present on a chromosome. It is the region that encodes the…

Q: () What is the function of RISC in eukaryotic gene expression?

A: Gene expression is the process of producing a specific protein. The expression of gene takes place…

Q: miRNA molecules act as specificity factors, which direct effector proteins to target ______…

A: Introduction :-  miRNA, or microRNA, is a type of small RNA molecule that plays an important role in…

Q: miRNAs target endogenous mRNAs in a sequence-specific manner. Explain, conceptually, how one might…

A: To explain: How to identify potential mRNA targets for a given miRNA if only the sequence of the…

Q: The RNA-induced silencing complex (RISC) I. binds to and unwinds ds siRNA/MIRNA to produce ss…

A:

Q: Alternative splicing helps to explain O why there are fewer MRNAS than there are human genes. O why…

A: Yes it is correct that Alternative splicing helps to explain the great variety in protein…

Q: A. rRNA is used to  transfer amino acids to the ribosome. make up the large ribosomal subunit. make…

A: Introduction :- Ribosomal RNA (rRNA), a molecule in cells that is exported to the cytoplasm and is a…

Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…

A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…

Q: Compare and contrast miRNAs and siRNAs [may have more than one correct answer]. A Both miRNA and…

A: "siRENA" is likely a misspelling of "siRNA" (small interfering RNA). There's no known biological…

Q: RNA processing events include A. self splicing B. methylation of 45S FRNA C. snoRNA facilitates…

A: Introduction: RNA processing involves newly transcribed RNA molecules (primary transcript)…

Q: Assume researchers are able to isolate the intact mRNA for a gene called qrs. The qrs mRNA isolated…

A: Messenger RNA is synthesized with the help of RNA polymerase taking the help of template strand of…

Q: B. What is different about the way in which these two DNA sequences increase the rate of…

A: The Catabolite activator protein (CAP) in E.coli activates transcription at more than a hundred…

Q: on this activity, what type of RNA is this molecule? A. Transfer RNA B. Micro RNA C. Circular RNA D.…

A: Introduction RNA (Ribose nucleic acid) contains the codons (3 consecutive nitrogenous bases) which…

Q: Which mechanisms are used by miRNAs to regulate expression? O Targeted degradation of mRNAs O…

A: Introduction: MicroRNAs (miRNAs) are non-coding endogenous single-stranded RNAs that play an…

Q: Match the items listed below with "eukaryotic" if they can be found in eukaryotic cells only,…

A: Polyadenylation signal sequence - Eukaryotic Shine Dalgarno sequence - Prokaryotic mRNA - Both tRNA…

Q: Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes…

A: RNA Polymerase II is responsible for the transcription of messenger RNA with the help of DNA. For…

Q: The RNA-induced silencing comp (RISC) I. binds to and unwinds ds siRNA/miRNA to produce ss…

A: A multiprotein complex called RISC contains one string of a small interfering RNA (siRNA) or micro…

Q: Eukaryotic RNA polymerase II is used to synthesize: a. rRNA O b. tRNA O C. O d. RNA from viral DNA O…

A: Transcription is the synthesis of RNA from DNA that is the process of copying the information of a…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: See Hint What structure is responsible for selecting and transporting only properly processed…

A: Introduction:- mRNA (messenger RNA) is a molecule found in cells that transports genetic information…

Q: d. Where would you find a mutation that affects transcription of this gene? e. Where would you find…

A: A human gene at molecular level consists of several parts like promoter where the transcription…

Q: You perform a northern blot to determine whether CFTR (Cystic fibrosis transmembrane conductance…

A: Cystic fibrosis transmembrane conductance regulator gene is involved in mucus, sweat and digestive…

Q: While miRNA response elements (MREs) may be located anywhere within an mRNA, they are most often…

A: Micro-RNAs are defined as a class or group of non-coding RNAs that will play an essential role in…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.