aminoacyl-tRNA

Q: 67 RNA interference was first discovered in Drosophila melanogaster. Yes or no 68 Which of the…

A:

Q: Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and 2 are…

A: Introduction :- Exons are the coding regions of an RNA transcript or the DNA that codes for it that…

Q: Which of the processes listed below are common in the post-transcriptional modification of…

A: mRNA is synthesized using DNA as template by a process called transcription. mRNA is generally…

Q: Label each true or false A.STTGATA3 is the consensus sequence of the -35 regulatory region of…

A: We all know that there are mainly two types of genes present in this world:1.Eukaryotic genes and…

Q: What happens when EF-Tu is mutated A. Be involved in transcription instead of translation B.…

A:

Q: Given the following sequence of mRNA, choose which tRNA will be next to incorporate: UAC…

A: The production of protein or polypeptide chain by using the mRNA codon is known as translation that…

Q: A particular mature miRNA (microRNA) in mice has sequence 5'-UUCCCUGAGACCUCAAGUGUGA-3'. a. If you…

A: Answer a) ii and iii ii) mRNA sequence complementary to the miRNA sequence iii) miRNA sequence with…

Q: The RNA-induced silencing complex (RISC) _____ i. Binds to and unwinds ds siRNA/miRNA to produce…

A: The answet is b. II only RNA-induced silencing complex(RISC) is a multiprotein complex which…

Q: A promoter is, choose the correct answer... a. the binding site for the ribosome on a messenger RNA…

A: Transcription is a process in which a transcript ( RNA ) is formed. It takes place by the common…

Q: twenty two Walter Gilbert coined the term ( ) for a sequence that appears in a mature RNA.…

A: 23) The ______________ pathway blocks mRNA translation or causes mRNA degradation. Ans) miRNA miRNA…

Q: Mature human insulin is synthesized from a single Gene but contains two polypeptide chains (A and B)…

A: Introduction Pancreas is a holocrine gland present in our body. It has both endocrine and exocrine…

Q: HDAC's are important enzymes involved in the regulation of Gene expression. This is because a. They…

A: HAT stands for Histone acetylase. HDAC stands for Histone Deacetylase.

Q: Which of the following statements uses the term homologous correctly?A. The two X chromosomes in…

A: Homologous genes refer to the genes that are inherited in two species by a common ancestor. These…

Q: Mutation of which of these sequences would have an effect on translational initiation?   A. 3’ UTR…

A: Introduction  Prokaryotic transcription is the process by which prokaryotic genetic material is…

Q: The T7 RNA polymerase has been used for production of recombinant proteins in E. coli cells. This is…

A: Question - The T7 RNA polymerase has been used for production of recombinant proteins in E. coli…

Q: In the table below the product of gene R binds to the promoter of gene A. What happens in (b)? a.…

A: Positive regulators are structural components that allow RNA polymerase to attach to the promoter…

Q: mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B.…

A: In eukaryotic cells, the primary transcript undergoes post transcriptional modification to form a…

Q: downstream

A: 82 ) Termination of the transcription occurs after the whole process of the transcription get…

Q: Given the following genetic network of a putative clock- controlled genes network that are regulated…

A: RNA Binding Proteins:  RBPs (RNA-binding proteins) are proteins that bind to double or single…

Q: Consider a mutation in -10 BOX promoter consensus sequence (TATAAT) in the prokaryote recA gene…

A: TATTAT is called pribnow box in prokaryotes and is a promoter sequence that tells the Enzymes where…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…

A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…

Q: 46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA…

A: Ribosomes are the protein factories of the cell. These are responsible for protein synthesis by…

Q: True or False. tRNA anticodons are antiparallel and complimentary in nucleotide sequence to their…

A: Transcription of eukaryotic genes does not give us a mature RNA but often a pre-RNA that requires…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: In which site(s) of the ribosome could you find a tRNA with more than one amino acid bound (a…

A: Introduction :- The peptidyl transferase is an aminoacyltransferase and the principal enzymatic…

Q: How is the splicing of U2-dependent introns different from that of U12-dependent introns? O a.…

A: The non-coding sequences are called introns and hence are needed to be removed from RNA. This is…

Q: Provide the SIGNIFICANT differences between the following: 1. Regulation AFTER transcription mRNA…

A: The process of mRNA processing involves the removal of the intron sequences and the joining together…

Q: Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes…

A: RNA Polymerase II is responsible for the transcription of messenger RNA with the help of DNA. For…

Q: The MRNA for a mammalian peptide that enhances electrolyte transfer to reduce paralysis was spliced…

A: The cells are of two types eukaryotic and prokaryotic cells. The primary difference between the cell…

Q: The TATA box binding protein binds to the TATA box. What is the DNA sequence of this region of the…

A: TATA box is a DNA sequence.

Q: Histone deacetylase (HDAC) enzymes   a.Promote initiation of translation. b.Complex with…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: An interesting phenomenon found in vertebrate DNAis the existence of pseudogenes, nonfunctional…

A: The existence of pseudogenes is an interesting phenomenon that is found in vertebrate DNA.…

Q: Nascent form of the mRNA  A. undergoes splicing only after capping B. is also called hnRNA C. is…

A: A. undergoes splicing only after capping B. is also called hnRNA D. participates in the spliceosome…

Q: 1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the…

A: Introduction  DNA (Deoxyribonucleic acid) sequence is the order of nucleotide bases (adenine,…

Q: microRNAs (miRNAs) play important roles in gene regulation. What is the correct order of steps…

A: A class of short, endogenous RNAs with a length of 21–25 nucleotides (nts) is known as microRNAs…

Q: Promoters always contain a

A:

Q: microRNAs (miRNAs) play important roles in gene regulation. What is the correct order of steps…

A: Small RNA molecules called microRNAs (miRNAs) are essential for controlling gene activity. They…

Q: Polypeptides are synthesized in the amino (NH,) terminus to carboxy terminus (COOH) direction…

A: The Central Dogma concept states that DNA makes RNA and RNA makes proteins. The three most important…

Q: If lacl-d and lacl+ subunits were continually expressed to equal levels in a bacterial cell, and if…

A: None of the lacl repressor tetramer will be fully functional.

Q: Control of gene expression in eukaryotic cells occurs at which level(s)? Lütfen birini seçin: O a.…

A: Eukaryotic cells can be defined as the type of cell which consists of the nucleus enclosed in the…

Q: Which of the following statements about trp operon regulation is TRUE? A. Low trp levels result in…

A: Lac Z is a gene that encodes the enzyme β-galactosidase, which catalyzes the hydrolysis of lactose…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.