mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B. Endonuclease C. 5’ 7’methylguanosine D. Polyadenylation E. snRNP function
Q: Suppose you wanted to study genes controlling the structure of bacterial cell surfaces. You decide…
A: To study the genes controlling the structure of bacterial cell surfaces, an individual decides to…
Q: Hemodynamics are the dynamics of blood flow. Can the Bernoulli's equation be used to study…
A: "Blood" is an extracellular matrix made up of plasma, red blood cells, platelets, and white blood…
Q: Important roles and functions of Microtubule-Associated Proteins (MAPs) *** for increase in…
A: Microtubules-Associated proteins(MAPs): These proteins interact with the microtubules of cellular…
Q: 1. What is the importance of these muscular and septal arrangement in earthworm? 2. How are the…
A: Earthworm It refers to a terrestrial invertebrate that comes under the phylum Annelida. This…
Q: explain the advanatges and disadvanatges of the importance of inflammatory response genes in CIN,…
A: It is believed that COX-2 plays a significant part in the development of colorectal malignancies.…
Q: Perspiration, known more commonly as sweating, is an autonomic bodily response that decreases body…
A: Perspiration (sweating) is the response generated by body when there is higher body temperature than…
Q: 3. Complete the table Membranes (name all) Interacts with receptors by Penetrates inside the cell by…
A: We all know that viruses are obligate parasites i.e. it cannot survive without host body.Viruses can…
Q: Give an example of an anaerobic traning exercise program using the FITT Principle
A: FITT PRINCIPLE: It is a method to create a perfect workout plan. It is presented with a structure…
Q: W.Compared with 1990s, more people are killed by cancer in 2000s and in 2010s. Determining right…
A: Cancer is a fatal disease that has both physical and mental consequences for a person. Cancer can…
Q: Why should we safely agree that insects incorporated into animal feed will impact the environment…
A: Livestock refers to any animal that is kept by humans for an economic purpose. This includes cattle,…
Q: Describe the steps including the roll of ion terminals in a neuronal action potential
A: An action potential is created when the voltage difference between the inside and outside of a…
Q: We know that human blood type is determined by a three-allele system at a single locus. For the…
A: ABO BLOOD GROUPING: The classification of erythrocytes () based on the inherited glycoproteins from…
Q: ESC (Embryonic Stem Cell) has ability to proliferate and differentiate into various cell types.…
A: Embryonic Stem Cell - The core cell mass of a blastocyst, an initial phase pre-implantation embryo,…
Q: Bacterial genomes such as that of E. coli typically have only a single origin of replication, from…
A: Introduction: E. coli is a member of the group of bacteria known as "coliforms." Coliform bacteria…
Q: Imagine you have three test tubes containing identical solutions of purified, double-stranded human…
A: Any individual's DNA includes genetic information. It is a double-helix nucleic acid consisting of…
Q: What was the biochemical reason for the "Ox Phos War," i.e., why was Peter Mitchell's hypothesis…
A: The Chemiosmotic Theory was first proposed by Peter Mitchell in 1961. It is the process by which ATP…
Q: n E. coli, the genes purC and pyrB are located halfway around the chromosome from each other. These…
A: Transformation, conjugation, and transduction are the three ways that DNA can be transferred between…
Q: Duchenne muscular dystrophy is caused by a recessive X-linked allele. A man with this disorder…
A: A genetic condition known as Duchenne muscular dystrophy (DMD) is characterised by advancing muscle…
Q: You create a premature stop codon as a result of an induced mutation in the lab. What type of…
A: Premature termination codons (PTCs) are the result of one-nucleotide changes that transform a…
Q: An elderly couple was killed in an accident. No surviving relatives are known, so their estate have…
A: ABO blood group has three alleles that are- IA, IB and i. IA and IB alleles are codominant with each…
Q: Write 3 ways in which culture, religious and social values affect dietary eating patterns?
A: There are many different dietary eating patterns that people can follow. Some people may choose to…
Q: Which of the following DNA regions is NOT involved in gene expression regulation in eukaryotes?…
A: Promoter-proximal elements are the DNA sequences present in eukaryotes. These are located close to…
Q: 8. Observe the sex-linked pedigree provided here that is tracking the red-green color- blindness…
A: Red green colorblindness is a disorder in which person is not able to distinguish between red and…
Q: explain how is scoliosis caused by abnormalities in somite development
A: Scoliosis is the lateral curvature of the spine or backbone. Scoliosis mainly affects children…
Q: An albino man marries a woman with normal skin color, but who had a mom that was albino. What is the…
A: A trait or feature of an organism is either dominant or recessive. Despite the fact that the…
Q: a. You have a test tube containing 5 ml of a solution of bacteriophages, and you would like to…
A: A viral plaque is defined as the visible structure formed on the culture plate of bacteria or any…
Q: What is the description of the growth and growth pattern of the microorganisms in the spread plate…
A: In the spread plate method, the growth of microorganisms is determined by the number of colonies…
Q: Which of the following is r Counting b-Fooding e-Freezing d-Media preparation e-Thawing 7. Which of…
A: The study of how animals and plants grow and develop is known as developmental biology. In addition,…
Q: One cost to sexual reproduction is that looking for a mate costs time and energy. Group of answer…
A: Introduction:- Reproduction is the biological process by which genetically similar offsprings are…
Q: Fill in the missing uppercase letters The map distances for four linked genes are as follows: A-B =…
A: Linkage is a phenomenon which determines how genes are placed in close proximity to each other on…
Q: Describe a human condition that results from the abnormal development of the heart
A: Heart is the most important organ, that pumps blood through out the body. The pumped blood carries…
Q: Cystic fibrosis is a degenerative disease that causes the progressive breakdown of the myelin…
A: Introduction Cystic fibrosis (CF) is a genetic disease that affects the lungs, digestive system, and…
Q: Place the following terms in the correct order 1-9 in the movement of actin filaments by myosin…
A: Muscle Contraction Is Triggered When an Action Potential runs along the Nerves to the Muscles.…
Q: The following are official combinations of electrolyte infusions EXCEPT: Oral Electrolyte…
A: Introduction Electrolytes are chemicals that conduct electricity when mixed with water.…
Q: When human tissue, such as skin or a blood vessel, is torn or cut, the cells in the damaged region…
A: Platelets is the constituent of blood cells other than red blood cells and white blood cells. These…
Q: In a survey of 1,150 women who gave birth in China in 2000, a total of 500 reported that they took…
A: Why this survey is important because to know the side effects of such drug on human body but…
Q: this is an example of biotechnology: In order to increase the yield of oil from canola, research…
A: Biotechnology is the branch of science that deals with the production of various products by using…
Q: Name and describe 5 muscles that are commonly torn or sprained and the mechanism that often leads to…
A: Our body is made up of more than 600 muscles.The muscles can be categorized mainly into 3 classes:…
Q: The degeneracy of the Genetic code is due to A. a 1 to 1 correlation between single amino acids and…
A: The production of polypeptide chain (proteins) from the mRNA is known as translation that occurs…
Q: Crystal Uric acid Amorphous urates Calcium oxalates Amorphous urates Calcium phosphate Triple…
A: Blood volume and concentration, as well as blood pressure, pH, and glucose levels are all controlled…
Q: Jon performed a pour plate technique to determine the concentration of viable cells in her mother…
A: INTRODUCTION Pour plate technique This technique helps in enumerating bacterial cells in a mixed…
Q: Genome type Capsid Envelope Viral replication occurs in Name viral enzymes located in the central…
A: Introduction - Viruses are neither classified as dead or alive. RNA in Viruses are usually unstable…
Q: Provide 2 examples of Diffusion, Osmosis, and Semi-Permeable Membrane (1 from the "Diffusion Through…
A: Diffusion and osmosis are quite similar which describes movement of substance from its a region of…
Q: Melvin, ace biology student, is m hypertonic" and "hypotonic" mean. Melv nembrane. The figure shows…
A: Hypertonic hypotonic and isotonic solutions are solutions which refers to the tonicity or a measure…
Q: Record your KIA results below. Indicate the color of the slant and butt (Yellow/Red/Fuchsia),…
A: Klinger's Agar is the differential medium used for the identification of the organism's abilities to…
Q: 2. Which molecules are the most abundant (by weight) in a cell? A. DNA, B. rRNA, C. water, D.…
A: A cell contains large number of simple and complex molecules and each of these molecules has very…
Q: Histological preparation of skin demonstrates dense unformed connective tissue. What layer of this…
A: Skin is composed majorly of Epidermis, Dermis ( papillary and Reticular), and Hypodermis. All these…
Q: 1. What is the organism reservior for Streptococcus agalactiae? 2. What is the clinical…
A: Streptococcus agalactiae is essentially a gram-positive coccus with an inclination to frame chains.…
Q: 10) A a base and a sugar. A) nucleoside B) base pair C) nucleotide D) complementary base E)…
A: According to bartleby policy we have to answer only first three multiple choice question hence…
Q: 41) Dideoxyribonucleotides (ddNTPs) are unusual in both the 2' and 3' hydroxyl groups have been aced…
A: Normally dNTPs that is the deoxy nucleotide tri phosphate are inserted into the growing DNA chain by…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- During the processing of pre-mRNA in eukaryotes Select one: a. Exons are joined together using polyadenylate polymerase b. The spliceosome breaks covalent bonds at 5' and 3' splice sites c. A 5'methyl cytosine cap is added using specific enzyme d. A 3'-poly-A tail is attached using an unusual 5'-5 ester linkageA principle function of 5' and 3' end modifications of eukaryotic mRNA is: a. to ensure that all nucleotides are phosphorylated b. to protect RNA from nucleolytic degradation c. to guide the removal of introns d. to serve as binding sites for translation release factors29. pre-MRNA transcript 5' 3' Open boxes represent introns Filled boxes represent exons A) Draw the MRNA to be translated if the pre-mRNA is constitutively spliced. S B) Draw an mRNA to be translated if the pre-MRNA is alternatively spliced due to exon skipping.
- Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene contains three exons. Identify the following items and, for each item, give a brief description of its function: a. 5′ untranslated region b. Promoter c. AAUAAA consensus sequence d. Transcription start site e. 3′ untranslated region f. Introns g. Exons h. Poly(A) tail i. 5′ capComplete each of the following statements by selecting from the bank of terms below. a. tRNA b. spontaneous c. repressible d. RNA processing e. mutagen f. SNRNA g. redundancy h. universal i. promoter j. elongation There are several three nucleotide codons that code for the same amino acid. This is known as (81). A specific three nucleotide codon for a fruit fly codes for the same amino acid as that same specific three nucleotide codon for a human. This means that the genetic code is (82). The three steps of transcription are initiation, (83), and termination. The (84) region on a chromosome is the sequence of nucleotides in DNA that indicates where the RNA polymerase complex should bind to initiate transcription. In a eukaryotic cell mRNA is modified in three ways. This is known as (85). The role of (86) is to combine with protein and then bind to introns to remove them and splice the RNA together. The role of (87) is to transport amino acids to the ribosome where the anticodon loop…All of the following apply to tRNAs EXCEPT: (more than one may apply) A. attach amino acids at the 5’ end B. have stems and loops C. are all encoded by a single gene D. an anti-codon of 5’AAC3’ corresponds to a codon of 3’UUG5’ E. exhibit distinctive 3D folds F. are acted on by 64 different aminoacyl synthetases G. are charged with amino acids by peptidyl transferase
- (a) Match the following list of RNAS (left side) with their function(s) (right side). w. MRNA X. rRNA y. snoRNA Z. snRNA aa, †RNA bb. scaRNA i. block translation of elected mRNAs ii. modification and processing of rRNA iii. modification of snoRNA and snRNA iv. components of ribosome v. spilicing of RNA transcripts vi. directs degradation of selected mRNAs vii. codes for proteins viii. adaptor for protein synthesis cc. miRNA dd. SİRNANascent form of the MRNA A. undergoes splicing only after capping B. is also called hnRNA C. is polyadenylated after splicing D. participates in the spliceosome assembly for splicing E. joins snRNPs to form the spliceosome assembly A A, B, D, E only (в) А, В, С only с) А, В, С, D, E (D) B, C, D, E onlyWhich of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids D. the genetic code is triplet Which protein can break covalent bond? * A. Helicase B. Primase C. SSB D. DNA gyrase What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'? * A. 3' C-A-T-A-T-C 5' B. 3' G-A-T-A-T-G 5' C. 3' G-A-U-A- U-G 5' D. 3' C-U-A-U-A-G 5' Which of the following statements concerning the " cloverleaf" shape of tRNA molecules is correct? * A. four hairpin loops are present B. three hairpin loops and one open end are present C. two hairpin loops and two open ends are present…
- 17) Which mRNA modification is likely absent if the mRNA is degrading prematurely from the 5’ end of the mRNA? A) addition of the 3’ polyadenylated tail B( splicing together if exons C removal of introns D RNA editing E addition of the 7- methlgguanosine cap to the 5’ end Consider the following gene with their respective introns and exons 5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequenceConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
![Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
![Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)