The T7 RNA polymerase has been used forproduction of recombinant proteins in E. colicells. This is because__ (select all correctanswers).Select one or more:а.T7 RNA polymerase has a specific promoter.O b. T7 RNA polymerase has a strong catalytic activity.С.T7 RNA polymerase has a strong binding affinity for RBS(ribosome binding site) of mRNA.O d. T7 RNA polymerase has an additional helicase activity.

The T7 RNA polymerase has been used for production of recombinant proteins in E. coli cells. This is because__ (select all correct answers). Select one or more: O a. T7 RNA polymerase has a specific promoter. а. O b. T7 RNA polymerase has a strong catalytic activity. O c. T7 RNA polymerase has a strong binding affinity for RBS (ribosome binding site) of MRNA. O d. T7 RNA polymerase has an additional helicase activity.

The T7 RNA polymerase has been used for production of recombinant proteins in E. coli cells. This is because__ (select all correct answers). Select one or more: O a. T7 RNA polymerase has a specific promoter. а. O b. T7 RNA polymerase has a strong catalytic activity. O c. T7 RNA polymerase has a strong binding affinity for RBS (ribosome binding site) of MRNA. O d. T7 RNA polymerase has an additional helicase activity.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 20QP: Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant...

See similar textbooks

Similar questions

Which one of the following isare true regarding the endogenous (made in the cell) miRNA a. They play a role in regulating the gene expression Ob. All statements are true O C. Only B&C are true d. miRNA genes encode them е. They have a loop-like structure The phrase GỌI cloned downstream of promoter in plasmid cloning means O a. GOI cloned before the promoter. O b. GOI cloned after the multiple cloning sites. O c. GOI cloned after the origin of replication. d. GOI cloned after the promoter. GỌI cloned inside the promoter sequence. е. Nucleotide misincorporation usually takes place during a. Replication b. Transformation Oc. High fidelity PCR d. Transposon insertion O e. Translation O O
The data below depicts the binding of the E coli RNA Polymerase to DNA containing a promoter sequence or random DNA. The data also illustrates the binding of the RNA Polymerase ins the presence of Protein X. What is the likely identity of Protein X? Justify your answer (limit 4-5 sentences). % Bound to DNA 120 100 80 60 9 20 0 DNA with Promoter 20 40 RNA Pol RNA Pol + Gene X 60 [RNA Pol] nM 80 100 120 % Bound to DNA 120 100 80 60 40 20 0 0 Random DNA RNA Pol RNA Pol + Gene X 20 40 60 [RNA Pol] nM 80 100 120
Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’
he bands indicated by arrow "A" (to the left of the western blot) most likely represent: A. PX-HA lacking any post-translational modifications. B. dephosphorylated PX-HA. C. phosphorylated PX-HA. D. PX-HA with its N-terminal signal sequence still attached. E. glycosylated PX-HA.
Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?
You genetically modified a bacterium so it can only produce ribosomes from a plant.The most immediate effect on this bacterium would be;A. Nothing. It would produce proteins as normal because the genetic code isessentially universalB. It may not be able to produce proteinsC. It would not be able to transcribe mRNAD. It would not be able to remove intronsSelect the best option above and explain why you chose that answer. Yourexplanation should include a description of the role of the ribosome in the cell andhow it interacts with mRNA and tRNA. As well as explanations for why the other options are not correct
O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) Lactose Lactose No Lactose Genotype PP0 Z Y/I P*O*Z•Y* I'POCZ Y*/I P* O©Z*Y° P O Z'Y/I P'OʻZ'Y* PP O ZY*/IP*O*Z*Y* IP OCZ Y /I P*O*Z•Y* IPO ZY*/I* P*O©Z*Y• I'PO*Z Y*/IP'O*Z*Y°
Below is a diagram of an Oscar Miller (Christmas tree) spread. Which of the following is true? Wy O a. this represented the first example in eukaryotes in which translation was visualized with the electron microscope O b. each "Christmas tree" represents the transcription of a single type of rRNA (i.e. 28S or 18S or 5.8S) O c. as drawn, transcription is proceeding from left to right Od.three nucleolar organizer regions are shown 1
Which of the following represents the sequence of an RNA transcript for which the template strand of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. DA. GUACUGGCUAGCUGCUAGAA B. UUCUAGCAGCUAGCCAGUAC с. ТТСТАGCAGCTAGCCAGTАС D. GTACTGGCТAGCTGCTAGAА
Six strains of E. coli (mutants 1–6) that had one of thefollowing mutations (i–vi) affecting the lac operonwere isolated.i. deletion of lacYii. ocmutationiii. missense mutation in lacZiv. inversion of the lac operon (but not an inversion ofthe lacI gene)v. superrepressor mutationvi. inversion of lacZ, Y, and A but not lacI, P, oa. Which of these mutations would prevent the strainfrom utilizing lactose?b. The entire lac operon (including the lacI gene andits promoter) from each of the six E. coli strainswas cloned into a plasmid vector containing an ampicillin resistance gene. Each recombinant plasmidwas transformed into each of the six strains to create partial diploids. In analysis of these strains, mutant 1 was found to carry a deletion of lacY, so thisstrain corresponds to mutation i in the list above.Which of the other types of mutations would be expected to complement mutant 1 in these partial diploids so as to allow lactose utilization?c. In part (b), each strain was plated on…
Describe the following a. Core enzyme RNA polymerase b. Sigma factor c. Promoter consensus sequence d. Rho Dependent Factor e. Intrinsic Factor f. Abortive Initiation
In the following figure, provide RNA sequence of Gene a and Gene b in a 5'-3' direction. Provide the DNA sequence of Gene c on the non-template strand. 4. Genes a and c are transcribed from the bot strand,... RNA DNA 5' 3 Gene a GGACCTA Gene b Gene c 3' 5' ACGTCAG RNA RNA UUAGAUC ...and b is transcribed from the top strand.