If lacl-d and lacl+ subunits were continually expressed to equal levels in a bacterial cell, and if the subunits associate with one another randomly, and if the presence of one lacl-d subunit can poison a tetramer, approximately what fraction of the lacl repressor tetramers formed would you expect to be fully functional? O A. none O B. 1/27 O C. 1/16 O D. 1/9 O E. 1/8

Q: IPTG (isopropylthiogalactoside) is commonly used to induce protein expression in Lac…

A: IPTG, also known as isopropyl d-1-thiogalactopyranoside, is a molecular biology tool. This substance…

Q: 67 RNA interference was first discovered in Drosophila melanogaster. Yes or no 68 Which of the…

A:

Q: Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and 2 are…

A: Introduction :- Exons are the coding regions of an RNA transcript or the DNA that codes for it that…

Q: Label each true or false A.STTGATA3 is the consensus sequence of the -35 regulatory region of…

A: We all know that there are mainly two types of genes present in this world:1.Eukaryotic genes and…

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: Mutations are the changes in the DNA sequence, the base sequence of the DNA changes. Mutations can…

Q: synaptic knobs of a nueron have what function? a. they release neurotransmitter into the synaptic…

A: The nervous system is the specialized system that controls the sensory and motor activity in the…

Q: E. coli are grown on a medium containing lactose. Once glucose is added to the medium, the bacteria…

A: In bacterial cells, the regulation of gene expression plays a crucial role in adapting to changing…

Q: What would the direct consequence to a cell be if there was a loss of function of Transcription…

A: Transcription is the process in which the DNA is transcribed into an mRNA. There are three basic…

Q: Comparing the -10 regions of two E. coli promoters which have identical -35 regions revealed the…

A: Transcription is a process by which the information a strand of DNA is copied into a new molecule…

Q: 3). Consider the four mutations (i-iv) described below: i. One of the mutations causing cystic…

A: A mutation is a permanent change in the DNA sequence of an organism's genome. Mutations can occur…

Q: Geneticists isolated six trains of E. coli (strains 1-6) whose lac operons had one of the following…

A: Lac operon It is an operon that is needed for the movement and metabolism of lactose in E. coli.

Q: Cancer cells removed from a patient's tumor have increased gene expression of several hundred genes…

A: Cancer  Cancer if a kind of disorder which caused by several means like drug, radiation, malfunction…

Q: Mutation of which of these sequences would have an effect on translational initiation?   A. 3’ UTR…

A: Introduction  Prokaryotic transcription is the process by which prokaryotic genetic material is…

Q: Transcriptional regulation often involves a regulatory protein that binds to a segment of DNA and a…

A: The process involved in regulating copying of instruction from the DNA into RNA is called…

Q: Comparison of different tissues shows that the ITY gene produces a 900 nt mature mRNA and a 190…

A: Alternative splicing is the mechanism that produces multiple mature mRNAs from a single primary…

Q: Question 7: Where would the lac repressor be bound in a wil coli cell that is growing in high…

A: Lac Operon is the cluster of genes which allows the transcription of the genes required for the…

Q: How would you describe the "purpose" of alternative splicing? Alternative RNA splicing... is a…

A: Nucleic acid is a macromolecule present inside the nucleus of cell . It stores genetic material and…

Q: Give one example of a prokaryotic system of gene expression that is more complicated (during…

A: Gene expression refers to the process by which the information stored in a gene is used to…

Q: Would the viral insertion of a proto-oncogene into a region of genomic DNA with non-acetylated…

A: Acetylation reduces the affinity between histones and DNA by removing positive charges. Thus,…

Q: The figure below shows 6 genes that are differentially expressed based on their specific enhancers.…

A: Enhancers are the regulatory sequences in the DNA located farther away from the transcription start…

Q: In the table below the product of gene R binds to the promoter of gene A. What happens in (b)? a.…

A: Positive regulators are structural components that allow RNA polymerase to attach to the promoter…

Q: A21. Two single-base substitutions in the trpA gene of E.coli both affected amino acid number 234.…

A: Missense mutation defines the alteration of genetic code/codon via the single base pair…

Q: Predict and explain the effect on GAL1 transcription, in the presence of galactose alone, of the…

A: Note: Hi! Thank you for the question. As per the honor code, we are allowed to answer three…

Q: Given the following genetic network of a putative clock- controlled genes network that are regulated…

A: RNA Binding Proteins:  RBPs (RNA-binding proteins) are proteins that bind to double or single…

Q: Consider a mutation in -10 BOX promoter consensus sequence (TATAAT) in the prokaryote recA gene…

A: TATTAT is called pribnow box in prokaryotes and is a promoter sequence that tells the Enzymes where…

Q: The IMD2 promoter contains three upstream transcription start sites (TSS) that are utilized under…

A: Inosine monophosphate dehydrogenase (IMD2) is a key enzyme in the purine biosynthesis pathway that…

Q: A mutation in the trp repressor gene that prevents the apo-repressor from binding the co-repressor…

A: Tryptophan operon Tryptophan operon is negatively regulated operon, it includes five gene, promotor,…

Q: Your investors are concerned that the GasP protein might not be sufficiently produced under normal…

A: Answer a. As the transcription of GasP protein has been 'triggered' by some chemical (abiotic…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: What would happen if a lysine residue that was normally acetylated was mutated to an arginine?  A.…

A: Lysine acetylation occurs in the eukaryotic and prokaryotic organisms and it mutates thousands of…

Q: Eukaryotes can control transcription by three overall type of process, they are ( selection from…

A: The regulation of transcription is more complex in eukaryotes as compared to prokaryotes. This…

Q: Which of the following is an example of allosteric regulation? A. the binding of CAMP-CAP to DNA B.…

A: Allosteric regulation is a form of regulation where enzymes or molecules are regulated by binding to…

Q: How is the splicing of U2-dependent introns different from that of U12-dependent introns? O a.…

A: The non-coding sequences are called introns and hence are needed to be removed from RNA. This is…

Q: Under the following conditions, what will be occurring with the lac operon? Glucose: Present…

A: lac operon is present in E.coli and contain genes that control lactose metabolism and only active…

Q: The MRNA for a mammalian peptide that enhances electrolyte transfer to reduce paralysis was spliced…

A: The cells are of two types eukaryotic and prokaryotic cells. The primary difference between the cell…

Q: A pharmaceutical company developed a drug, CP788, that inhibits the interaction of Grb2 with SH2…

A: Grb2 ( growth factor receptor bound protein 2) is an adaptor protein whose function is to bring…

Q: Which ONE of the following is TRUE concerning the so‐called Philadelphia chromosome? Select one:…

A: Chromosomal deletion is simply deletion of the part of the chromosome. Chromosomal inversion is a…

Q: Hac1 is another chaperone protein that is up-regulated in response to unfolded proteins in the ER.…

A: Introduction  Proteins are essential biomolecules that play a wide range of roles in controlling…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.