Item in the let colum enter in the indicated space the best mato fight column. Right Column Match A group of proteins that promote gene silencing by including specific SİRNAS and/or miRNAS A. Pasha (partner of Drosha) B. let-7 (miRNA) It converts primary miRNAs (pri-miRNA) into precursor MİRNAS (pre-miRNAS) for miRNA maturation C. RISC (complex) It is a gene whose transcript is targeted for degradation when it is bound by miRNAS D. lin-4 (MRNA) It is processed by Dicer after exogenous dsRNAs were injected (typically not encoded in an organism's genome) E. SİRNA (short interfering RNA)

Q: Introduction of dsrna into cell:   mrna immediately degraded   dsrna translocated to the nucleus…

A: RNA is made up of sequence of ribonucleotides.

Q: RNAi...  result in product of dsrna or sirna to sirna or mirna! does it increase or decrease…

A: RNA i or RNA interference is a natural process occurs; in most of the eukaryotes;post…

Q: A class of short noncoding RNAs that regulate gene expression. Group of answer choices snoRNA siRNA…

A: Introduction: Small non-coding RNAs (MicroRNA, Small nuclear RNA, Small nucleolar RNA, tRNA derived…

Q: II. Identify what the mRNA, tRNA and amino acid for the DNA bases below. DNA bases below can be…

A: The mRNA and amino acids sequences can be deduced by DNA sequence. The mRNA sequences are…

Q: A particular mature miRNA (microRNA) in mice has sequence 5'-UUCCCUGAGACCUCAAGUGUGA-3'. a. If you…

A: Answer a) ii and iii ii) mRNA sequence complementary to the miRNA sequence iii) miRNA sequence with…

Q: Match each of the following descriptions to the type of regulatory RNA affecting a "target" gene…

A: Of course! Let's break down each match:This regulatory RNA may increase transcription of the target…

Q: Mature siRNA annealed to its target usually leads to mRNA slicing when: the target mRNA is lacking…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid). To…

Q: What are functions of the M7G cap? Select all the apply. Slows degradation from the 5' end of the…

A: The process by which mRNA is produced from DNA is called transcription and the process by which…

Q: MicroRNA (miRNA) in eukaryotes are similar to anti-sense RNA in bacteria in that they regulate…

A: RNA is one of the three principal biological macromolecules required for all well-known life forms…

Q: Which of the following genes have internal promoter elements? 5S FRNA MRNA snRNA None of the above

A: Promoter : the sequence that are important in the initiation of transcription of a transcription…

Q: The foloving dagram represents a transcription unit (a gene) and corresponding RNA transcripts being…

A: The piece of DNA that take part in transcription is called transcription unit. Transcription unit…

Q: Which of the following is NOT true of miRNAs?   A. Pri-miRNAs are processed by Drosha in the…

A: A microRNA, also known as a miRNA, is a single-stranded, non-coding RNA molecule that is very small.…

Q: In the figure below, what is represented by the line labeled A? TFIIB recognition element DNA in m…

A: Transcription of genes includes the formation of RNA using the template DNA. It includes the enzyme…

Q: In table 21.1, the effects of injection of different types of RNA into wild type mice was examined.…

A: miRNA(micro RNA) is type of non coding, single strand RNA. It involves in gene silencing and…

Q: The core RNA polymerase of E. coli cells may bind (select all correct answers) Select one or more:…

A: RNA polymerase(RNAP) is the core enzyme of gene expression and a target of regulation.In…

Q: You saw this figure many times during the WC1 group work.   To get from the biomacromolecule(s)…

A: Biomacromolecules are the complex polymers of different monomer units (simple). In a human body,…

Q: Compare and contrast miRNAs and siRNAs [may have more than one correct answer]. A Both miRNA and…

A: "siRENA" is likely a misspelling of "siRNA" (small interfering RNA). There's no known biological…

Q: How to say this in a simple english. I want to understand it please RNA vaccines are stimulated in…

A: The vaccines are developed to prevent getting an infection. The first vaccine was developed against…

Q: Which of the following is not part of miRNA formation? -Pri-miRNA -Pre-miRNA -Dicer -RISC…

A: miRNA is considered as a non-coding molecule of the RNA, which plays an important regulatory…

Q: TRNA and 5S RNA genes both have the following internal control region. BoxA BoxB BoxC

A: An internal control region is determines as a sequence that is made up of DNA and is located only…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: Protein Z in the figure below depicts the activity of which bacterial Nucleoid Associated Protein…

A: The genetic material in bacteria is DNA. To fit the bacterial chromosome inside the tiny bacterial…

Q: microRNAs (miRNAs) play important roles in gene regulation. What is the correct order of steps…

A: A class of short, endogenous RNAs with a length of 21–25 nucleotides (nts) is known as microRNAs…

Q: p53 is an activator of a miRNA called miR-145. miR-145 targets c-myc, a gene that promotes cellular…

A: Increased proliferation and survival.Explanation:Increased proliferation and survival would be the…

Q: . Based on this information, which of the following statements would be supported by these results?…

A: BRCA1  It is a human tumor suppressor gene and suppress the growth of tumor cells.

Q: microRNAs (miRNAs) play important roles in gene regulation. What is the correct order of steps…

A: Small RNA molecules called microRNAs (miRNAs) are essential for controlling gene activity. They…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.