Protein Z in the figure below depicts the activity of which bacterial Nucleoid Associated Protein that may silence gene promoters (select one)? A. Protein HU B. Histone H3 C. Dps D. Integration Host Factor E. H-NS

Protein Z in the figure below depicts the activity of which bacterial Nucleoid Associated Protein that may silence gene promoters (select one)? A. Protein HU B. Histone H3 C. Dps D. Integration Host Factor E. H-NS

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: 10. a. Describe an operon? b. How lac operons controls gene expression in bacteria

A: (a) An operon is a functional unit of DNA containing a set of genes including structural gene, a…

Q: 69) in the first round of translation in Sheeppoxviruses the products are a. the proteins go back to…

A: * sheep pox also known as variola which is an highly contagious disease of sheep due to a poxvirus…

Q: As trytophan levels increase in the cell, _____ bind(s) to active aporepressors, causing ______ of…

A: trp operon: The trp operon codes for the components required for tryptophan production. An operon…

Q: A double stranded region of RNA that can stall ribosomes is a(n) A. repressor sequence B. operator…

A: The RNA is produced from the DNA by transcription process and this RNA is used during the…

Q: Retroviruses such as HIV, Herpesviruses, and Hepatitis B can be effectively inhibited by _____. Mark…

A: Nucleoside analogs such as acyclovir are antiviral drugs that can effectively inhibit the…

Q: β-globin gene indicate that some areas are more sensitive than others. When mutations occur in…

A: Promoter is a sequence in the DNA where RNA polymerase recruites itself. It is a very crucial region…

Q: biguitation lêdds to . Degradation of protein into amino cids =. Attack of ubiquinated protein by…

A: Ubiquitylation (sometimes called ubiquitination or ubiquitinylation) is an enzymatic…

Q: 1. The SRP is recognized by the SRP receptor. 2. The ribosome translates the protein through the…

A: NOTE- as per our bartleby guidelines we are not allowed to answer more than one question at a time…

Q: Genes of related function frequently cluster into: please explain the answer a.transcripts…

A: Gene is the functional part of the DNA that undergoes transcription and produce RNA. They have a…

Q: The picture below is the structure of a bacterial Nucleoid Associated Protein (NAP) associated with…

A: In bacterial cells, the genetic material is organized and compacted into a structure called the…

Q: Researchers have identified a mutation in the LMNA gene, which encodes some of the pro- teins in the…

A: The intermediate filament proteins lamins A and C are encoded by the LMNA gene, which is found on…

Q: The gad operon is controlled by a number of transcription factors that regulate a promoter of…

A: Bacteria re found in prokaryotes. They are more primitive as compared to eukaryotes.

Q: 100) The HA protein of Influenza vaccine is a. The HA1 is responsible for binding to unexposed…

A: Answer :- Option (B) is correct. - The HA protein of influenza vaccine is the HA protein of the…

Q: Molecules in higher eukaryotes that are directly involved in gene silencing include all of the…

A: A gene is a stretch of nucleotides present in the DNA. It codes for the synthesis of an RNA or…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…

Q: Lac Repressor A Operator Lac Y eene Promoter Lac Z eene Lac A gene В Lac Y eene Lac A gene Promoter…

A: Lac operon consists of a group of genes that codes for a protein that allows bacteria to use lactose…

Q: The core RNA polymerase of E. coli cells may bind (select all correct answers) Select one or more:…

A: RNA polymerase(RNAP) is the core enzyme of gene expression and a target of regulation.In…

Q: Under the following conditions, what will be occurring with the lac operon? Glucose: Present…

A: lac operon is present in E.coli and contain genes that control lactose metabolism and only active…

Q: Ions will flow _________ a concentration gradient. Around Up Down Parallel to

A: The movement of ions depends on the concentration gradient of the ion across a membrane.

Q: Which of the following regions of the DNA is transcribed by RNA polymerase AND is “understood” by…

A: Transcription Transcription is the process where DNA is transcribed into RNA with the help of…

Q: The effect that allolactose has on LacI is a. causing it to block binding of the CAP protein. b.…

A: Operons are clusters of genes in prokaryotes which are under the regulation of the same promoter…

Q: Translate the following mRNA transcript 5’CGCCGAUGCGCGAUAUGUGGUAA’3 A. RRCAICG B. ADARYVV C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: Poliovirus contains a protein that possesses an NLS. A drug is developed that binds and hides this…

A: NLS or nuclear localization signal IA an amino acid sequence that tags a protein for import into the…

Q: A study was conducted to determine the importance of Nucleoid Associated Proteins (NAPs) by deleting…

A: 1- Nucleoid-associated protein (NAPs): These are small DNA binding proteins which can alter the DNA…

Q: For transcription of middle promoters in T4 phage, the anti-sigma factor, AsiA, will а. bind -10…

A: The bacteriophage T4 Alt gene product is a component of the phage head and, together with the phage…

Q: What is an example where p27 kip1 can remain in the nucleus performing its inhibitory effect? A.…

A: INTRODUCTION Mitogen-dependent progression through the primary gap phase (G1) and initiation of DNA…

Question

Protein Z in the figure below depicts the activity of which bacterial Nucleoid Associated Protein that may silence gene promoters (select one)?

A. Protein HU

B. Histone H3

C. Dps

D. Integration Host Factor

E. H-NS

AT-rich
AT-rich
AT-rich
Protein Z
silenced
AT-rich
W

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Packaging of the bacterial chromosome

VIEW

Step 2: Answer with explanation

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

What do you call the site of activators that bind to the DNA molecule ? A. enhancer B. operon C. operator D. II E. I
If there is a mutation in importin that prevents it from interacting with the NLS of cargo proteins, what affect, if any, would this have on the UPR (unfolded protein response). A. Ran-GEF would bind to the importin promoting cargo entry into the nucleus and transcription of UPR response genes. B. Gene regulatory protein would not be imported into the nucleus thus preventing transcription of UPR response genes C. MRNA would not be imported into the nucleus thus preventing transcription of UPR response genes D. Ran-GTP would not be imported to the nucleus thus preventing transcription of UPR response genes E. No effect, these are completely unrelated processes.
Match the sequence to its function. Promoter Start codon Regulatory gene Operator Structural gene A. Encodes protein controlled by operon B. Encodes repressor C. Binding site for repressor D. Binding site for RNA polymerase E. Binding site for ribosomes
Two component systems in E. coli often refer to: Select one: an activator and a repressor for gene transcription O a. O b. a specific mRNA and an anti-sense small RNA. O c. a toxin and an anti-toxin O d. a kinase and its substrate protein
Explain how the lac operon is regulated under the following conditions. Include the following terms in your answers: Repressor, Operator, RNA polymerase, CAP site, CAP protein, Promoter A. Lactose and glucose are both present. B. Lactose and glucose are both absent. C. Lactose is present and glucose is absent.
To start transcription, RNA polymerase binds to a please explain your answer a.initiator complex b.promoter sequence c.trigger factor d.Rho factor e.Shine-Dalgarno sequence
The tryptophan operon is a repressible operon that is A. transcribed only when glucose is present in the growth medium B. not transcribed whenever tryptophan is plentiful in the growth medium C. permanently turned on D. turned on only when tryptophan is present in the growth medium
Which of the following molecules will experience a large change in cytoplasmic concentration whenthe above tryptophan operon is turned on (in E. coli cells)?A. tryptophan molecules will decrease in concentrationB. lactose molecules will decrease in concentrationC. tryptophan molecules will increase in concentrationD. lactose molecules will increase in concentrationE. none of the above
Stem cells (cells with little or no determination) are useful in many kinds of biological research for which of the following reasons? Group of answer choices A. they do not have particular cell fates B. None of their DNA is methylated C. They have unique cytoplasmic determinants D. They have no microRNA E. They have not differentiated