(Met pro UAC GGG AUGCCCACG UAG MŘNA a. 5' and 3' ends of the mRNA b. A, P, and E sites c. Start codon d. Stop codon e. Amino and carboxyl ends of the newly synthesized polypeptide chain f. Approximate location of the next peptide bond that will be formed g. Place on the ribosome where release factor 1 will bind

Q: if there are multiple start condo, how can you identify the real start codon? a) By observing…

A: The DNA or RNA sequence consists of three nucleotides and determines the particular amino acid that…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.

A: RNA stands for ribonucleic acid. It is a complex compound comprising of high molecular weight and…

Q: Which of the following statements regarding "start" and "stop" signals apply to both transcription…

A: Introduction  The process of synthesising RNA from a DNA template, known as transcription, converts…

Q: What is an Okazaki fragment, and how are they later “glued” together?

A: In the semi discontinuous mode of replication when DNA unwinds , one strand is synthesized…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Briefly explain the importance of the 5'-cap in the translation process. Do not simply define the…

A: Introduction :- During transcription, the 5' cap is inserted to the first nucleotide in the…

Q: Choose the answer that has these events of the elongation phase of translation in the proper…

A: Translation refers to the production of proteins using mRNA and ribosomal machinery. The ribosome…

Q: The chemical bisulfite transforms cytosine (C) to uracil (U) (U). In DMSO, bisulfite is dissolved.…

A: Dimethyl sulfoxide is an organosulfur compound with the formula (CH₃)₂SO. The chemical bisulfite…

Q: Consider this list (below) of steps involved in translation. These steps are out of order.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: Using a table that shows which codon represents which amino acid determine the following:   A)…

A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…

Q: The piece of RNA below includes the region that codes for the binding site for the initiator tRNA…

A: Translation is a fundamental process in molecular biology that converts the genetic information…

Q: For each of the following initiation factors, how would eukaryoticinitiation of translation be…

A: Initiation factors are a kind of proteins, which bind to the smaller subunit of the ribosome. This…

Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…

A: Option b

Q: Which of the following would form a structure that is a cue for transcription termination of some…

A: There are a few important points: Transcription is the process of formation of transcript (RNA) RNA…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…

A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…

Q: Please describe the four-step process of the elongation during protein translation in bacteria.

A: Translation is  the process of formation of proteins from mRNA with the help of ribosomes in the…

Q: There are three termination codons (UAA, UAG, UGA) but usually only one initiation codon (AUG) is…

A: The initiation codon is also referred to as start codon which marks the beginning of the translation…

Q: The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1:…

A: BASIC INFORMATION TRANSCRIPTION  It is responsible for the formation of hnRNA which has the codes…

Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…

A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…

Q: Use the numbers below to indicate the correct order of events (from left to right) during the…

A: Hi, Thanks For Your Question.  Answer : Correct Sequence Is 3 4 2 1 5.

Q: Describe what is happening at each of the four stages of translation shown in the above diagram-

A: The translation is a process by which the genetic code contained within a messenger RNA molecule is…

Q: Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for…

A: The original mRNA sequence:5'-UUG ACC GAC-3'To determine the amino acid sequence, it is important to…

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: 5' Figure 2 below is a schematic diagram illustrating a short gene with 5000 bp of an unknown…

A: Transcription is defined as a process in which a transcript (RNA) is formed.  It is a unidirectional…

Q: List the components required for translation. Describe the relative sizes of these different…

A: The translation is a process through which the polypeptide chain is synthesized based on the…

Q: Consider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: 70

A: The conversion of information saved in the DNA to proteins is required. The central dogma describes…

Q: A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is…

A: DNA is the genetic material of the cell which gets transcribed into mRNA with the help of RNA…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents…

A: The protein is synthesized by the process of translation. It takes place in cytoplasm of cell.

Q: Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000…

A: Introduction :  In mRNA transcripts, introns are referred to as interfering sequences. These are the…

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: Describe the prokaryotic translation initiation shown in the diagram. Define the convention of…

A: In bacteria initiation factor are required .Initiation factor 3(IF3) prevents 30S subunit binding to…

Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…

A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: DNA is the store house of genetic information. This information is transferred to mRNA through the…

Q: The figure below shows the stage in translation when an incoming aminoacyl-tRNA has bound to the A…

A: Step-2:  The peptidyl transferase is a part of large subunit of ribosome (23S rRNA). It function as…

Q: Metenkephalin is a small peptide found in animal brains that has morphine-like properties. Give an…

A: DNA is transcribed into mRNA. The mRNA contains a tripeptide sequence known as codons that code for…