Incorrect The mechanism by which DNA is licensed to replicate only once during each S phase involves ORC and helicase loaders binding to geminin. MCM proteins binding to geminin after replication ORC and helicase loaders being phosphorylated. MCM proteins binding only to replicated DNA. MCM proteins binding only to CEN DNA. 0/1 pts
Q: Analyze the impact of the Physician Self-Referral Law on a healthcare organization’s reimbursement,…
A: Introduction The Physician Self-Referral Law, commonly known as the Stark Law, prohibits physicians…
Q: The measles virus has a basic reproduction number (R0) of 15. To achieve herd immunity, what…
A: The basic reproduction number (R0) represents the average number of new infections caused by a…
Q: Select all of the following that are true regarding platelets. Question 18 options:…
A: The question is asking us to identify the correct statements about platelets from the given options.
Q: Hiiiiiiiiiii
A: There is a strong connection between genetics and sexuality, with sexuality playing a substantial…
Q: Q 9: What is standard deviation? Why is it useful in anthropometry? Q7: How might sexual dimorphism…
A: Standard deviation is a statistical measurement that describes how spread out or dispersed the…
Q: 4. The diagram below shows the original order of the genes on an autosome in Drosophila: C D EFGHI…
A: You may refer to the following references for the answers:…
Q: What is the difference between a prophylactic and a treatment? Which do you think is more likely to…
A: To thoroughly analyze the approach to solving the question regarding the difference between…
Q: 3. Research the condition situs inversus (also known oppositus or situs transversus). This condition…
A: Approach to Solving the Question:Understanding Situs Inversus: Begin by explaining situs inversus,…
Q: 3. Diet Big Red soda contains citric acid, as shown in the ingredient list below, Carbonated…
A: Analyzing the composition of soft drinks like Diet Big Red soda includes particular chemical and…
Q: You isolate genomic DNA from brain cells and heart cells and use PCR to amplify the promoter region…
A: Referencehttps://www.genome.gov/genetics-glossary/Promoterhttps://www.genome.gov/genetics-glossary/M…
Q: Which of the following are important for pulling chromosomes to the poles of the cell? Choose all…
A: The 3 answers are be: kinetochore MT, astral MT , and polar MT The explanation is simple.…
Q: Relative Hormone Concentration 8 12 ♡ Days of Estrous Cycle The graph above shows the hormonal…
A: Approach to solving questions about a graph:Identify the key elements:Labels: Look for titles, axis…
Q: Please help
A: Step 1:Q.1.1 Here is your answer:Sa ≤s person Data Analysis for Ba ≤ Pty Ltd.Comp ≤ t ∈ gthe Tab ≤…
Q: What are the five mass extinctions of the past and the current theory of the sixth mass extinction?…
A: The objective of the question is to understand the five major mass extinctions that have occurred in…
Q: Describe how restriction enzymes like EcoR1 are used to create recombinant plasmids and what the…
A: The next stage is called "isolation of target DNA," and it involves removing the DNA that contains…
Q: just answer the questions nothing to conpl
A: Approach to solving the question: Offspring-List the phenotypes (both color & number) The…
Q: Mendelian Genetics - More Practice AAA Ha b Bb bb 1. A tetrahybrid individual, AaBbCcDd, is crossed…
A: The cross in the above question is AaBbCcDd X AABbCcdd Now we will calculate the probability…
Q:
A: Approach to solving the question:1. Understand the context: The question is asking about the…
Q: Would breathing pure oxygen cause a large increase in oxygen transport by the blood in a healthy…
A: Inhaling pure oxygen can influence a person's body in several ways depending on their overall health…
Q: Which of the following is a genotypic frequency? O aa = = 24% O A= 54% O a = 46% O Brown hair = 33%
A: To determine which of the given options represents a genotypic frequency, let's review what…
Q: You have a patient with abnormally high IgE antibodies. What are two scenarios that might lead to a…
A: Possible Scenarios Leading to High IgE Antibodies1. Allergic Conditions:High levels of IgE…
Q: Which of the following statement regarding the whole-pathogen vaccine is/are correct (B) Live…
A: In order to tackle this question, it is crucial to comprehend the attributes of live attenuated and…
Q: Do the cells migrate to new locations during development and form selective adhesions with other…
A: Amid the early stages of development, cells alter a lot. They not only do diverse things, but also…
Q: When virulent bacteria invade an organism, they usually inflict damage to it. Can you assess the…
A: let's delve deeper into each of these mechanisms: Toxins Production:Exotoxins: These are proteins…
Q: ny pairs of sister taxa differ markedly in their numbers of extant species. In this chapter we saw…
A: Evolutionary science places a extraordinary deal of emphasis on the assortment of species inside…
Q: True or False : CRISPR is a novel method for reliably amplifying gene products so that they can be…
A: Certainly! CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a groundbreaking…
Q: Think about a forest. Cultural services we get from the forest include is and One provisioning…
A: Approach to solving the question: Considering all the given options, a solution has been initiated…
Q: Genetics Q7
A: The question is asking about the direction of movement of DNA during gel electrophoresis, a…
Q: Explain how the ATP pathway is similar to a rechargeable battery
A: Adenosine triphosphate or ATP is the energy currency of the cell. It is composed of three phosphate…
Q: hat are orthologs ?
A: Orthologs are genes in particular species that separated from a common predecessor gene due to…
Q: A premature infant typically lacks subcutaneous adipose tis- sue. Also, the surface area of an…
A: A imperative physiological work, thermoregulation, the capacity to regulate body temperature…
Q: What scenario could lead to the founder effect in a population? Natural selection acting on genetic…
A: The objective of the question is to identify which scenario could lead to the founder effect in a…
Q: Microarrays a. must be preceded by a sothern blot b. compare gene expression levels across many…
A: Here's why the other options are incorrect:a. must be preceded by a southern blot: Southern blots…
Q: Microorganisms that cause disease only when the body is already immunocompromised in some way or…
A: Option a: This option is incorrect because even in people who are feeling well, virulent viruses can…
Q: How do we assign fossil specimens to biological species that are recognized today?
A: Recognizing fossil specimens and connecting them to modern-day biological species is a vital and…
Q: In what stage of mitosis is the cell labeled "A"? A shutterstock B www.shutterstock.com 159810452 O…
A: During metaphase, which is a crucial stage of mitosis, the cell undergoes several key events as it…
Q: If there are 103 cells per mL at the middle of log phase, and the generation time of the cells is 30…
A: To unravel this, we have to calculate how numerous times the cells isolated in 2 hours, given that…
Q: In which direction would an MRI scanner move to produce sequential images of the body in the frontal…
A: The MRI (Magnetic Resonance Imaging) scanning refers to an apparatus, wherein the magnetic fields…
Q: What are the three temporal stores for memory? Why does neuroscience see fit to add a fourth store…
A: Memory in the human brain is typically categorized into three temporal stores: the sensory, short…
Q: 18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would like to…
A: PCR (Polymerase Chain Reaction) is a laboratory technique used to amplify specific regions of DNA.…
Q: You are conducting an ecological study of two populations of invasive Italian Wall lizards in New…
A: 1. **Estimated Population Size Comparison:** - In the Bronx, you marked 18 lizards initially and…
Q: The Andes Mountain Range is located along the western coastline of South America and includes a…
A: let's delve into more detail:(a) The Andes Mountain Range is the result of the convergence of two…
Q: What is the slope factor for a human and plot the dose-response curve. What is the concentration in…
A: Question:What is the slope factor for a human and plot the dose-response curve. What is the…
Q: Some sperm mitochondria enter an egg during fertilization, but as sperm mature these mitochondria…
A: Fertilization in people alludes to the combination of male and female gametes that facilitates the…
Q: Description of Activity Prevents the repair or synthesis of phospholipids Breaks open bonds between…
A: let's delve into each aspect in more detail: 1. Cidal or Static: - **Cidal Agents:** These agents…
Q: When Mendel crossed yellow-seeded and green-seeded pea plants, all the offspring were yellow-seeded.…
A: The allele for yellow seeds should be written in uppercase letters, while the one for green seeds…
Q: Which are the most important factors determining the magnitude of the pulse pressure?
A: Pulse pressure, a necessary cardiovascular well-being marker, is characterized as the difference…
Q: Question 6. What are the first three amino acids in the protein that is produced from this gene?…
A: Transcription:Transcription is the process by which the DNA sequence is converted into mRNA. In DNA,…
Q: The table below shows the water quality results of palm oil mill effluent (POME) which you have…
A: Palm Oil Mill Effluent (POME) could be a byproduct produced from the processing of palm oil, which…
Q: Detail the molecular pathophysiology that leads to cystic fibrosis-related diabetes.
A: Cystic Fibrosis-related diabetes (CFRD) is a common and important complication of cystic fibrosis…
Step by step
Solved in 2 steps
- If a mutation occurred that prevented single stranded binding proteins from binding, the result would be: O Replication would not be initiated O DNA would be synthesized on the leading strand, but not the lagging strand Replicating would be initiated, DNA would unwind, RNA primers would be laid down, but DNA polymerase would not bind O The newly synthesized RNA would not be able to leave the DNA template Replication would be initiated, but RNA primers would not anneal to the DNAWhich of the following statements is NOT TRUE about genomic DNA replication? O A DNA replication begins at the origin of replication and proceeds bi-directionally O B. New nucleotides can be added by the DNA polymerase only to the 3 end of the growing strand O. Synthesis of new DNA is catalyzed by the enzymes called DNA polymerases OD. DNA replication is semi-conservative OE. DNA replication proceeds continuously on both parental DNA strands.Which of the following statements regarding DNA synthesis at the ends of linear chromosomes is true?
- (Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose one: GAUDIe copy of a DNA molecule. complementa DNA replication is known exact molecule has 1 original stChoose one: 1 new strand of DNA. This ensures the conservation of genetic information. because each new DNA (Select one answer from each dropdown menu: ) In mitosis, the goal is to get cells that are genetically Choose one: This process is used to make Choose one: Match the following Mitosis stages to what happens Prophase Metaphase Anaphase Telophase a. sister chromatids pull apart to opposite ends of cell b. chromosomes line up at the equator of the cell c. Nuclear envelope reforms and chromosome loosen d. nuclear envelope disappears, chromosoměs a. condense During what phase does the cytoplasm divide? (Select one answer from dropdown menu:) Choose one: (Select one answer from each dropdown menu and fill in the blank:) In meiosis, the goal is to get cells that are genetically Choose…Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.Which of the following are true about bacterial DNA replication compared to DNA replication in humans (eukaryotes) (select all that apply) Bacteria can replicate their entire genome more quickly than human cells can Bacteria DNA replication uses more types of DNA polymerase than human cells do Bacteria can replicate DNA continuously, but eukaryotes wait for the S phase of the cell cycle Bacterial DNA replication does not require helicases, because the chromosome is circular DNA sequence where replication initiates are rich in A's and T's in eukaryotes, but not in bacteria Bacteria have more origins of replication than human chromosomes do
- During DNA replication, one of the new strands of DNA is synthesized continuously, while the other is synthesized as a number of separate fragments of DNA that are subsequently linked by DNA ligase. This is because O replication starts at many points on the chromosome RNA primers only anneal to one of the parental strands of DNA one of the parental strands is unwound slower than the other by helicase DNA polymerase III only synthesizes DNA in the 5' - 3' directionLabeling DNA Replication Directions: Drag the lahels from the left tn corrary derti theinats of ar=rlicating strandarA 24 Newly Created Strand of ONA Replication Carke Original DNA Strand Replication Direction of Origin of Replication Directions: Bolow is a more in-depth look at a replication bubble. A.l of the psrts are still tne came, butHow does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.
- Discuss DNA replication of prokaryotes and please mention all of the enzymes and components listed below. DNA Primase – DNA directed “RNA Pol” which inserts nucleoside triphosphates (NTPs) Primers are oligonucleotides; priming process is the formation of primers DNA Helicase – separates the DNA in advance of the replication fork (in E. coli DNA Helicase II); binds at AT-rich region of DNA; ATP then binds the helicase Single-stranded DNA-binding Protein (SSBP) – no enzymatic activity; does not consume ATP Topoisomerase – alter the supercoiling of double-stranded DNA DNA Ligase – nicking of strands done for replication to continue Okazaki fragments DNA Polymerase – removes primer via 5’ to 3’ exonuclease activity; comes again for 5’ to 3’ polymerization activity (closes the gap between Okazaki fragments) Prokaryotes DNA Pol I – auxiliary enzyme to DNA Pol III; repairs damage; capable of excising pyrimidine dimers; polymerization via single active site that can bind all 4 dNTPs;…Why are Gyrase inhibitors good antibiotics to use therapeutically? DNA Gyrase is required by prokaryotes, but not eukaryotes, to complete chromosomal replication so it's a good target to inhibit. O DNA Gyrase is required by eukaryotes, but not prokaryotes, to complete chromosomal replication so it's a good target to inhibit. It's impossible to develop resistance against Gyrase inhibitors so they are always effective. O DNA Gyrase is required by both prokaryotes and eukaryotes to complete chromosomal replication so it's a good target to inhibit.Which of the following statements regarding the fidelity of DNA replication is true? DNA polymerase has a 3'-5' exonuclease activity that removes incorrectly paired nucleotides. The DNA polymerase active site is highly flexible and can easily 'fit' incorrectly paired incorporated nucleotides. I. DNA polymerase never makes an error in the nucleotide being incorporated. The stability of base pairing is not a factor in controlling the fidelity of nucleotide incorporation during replication. IV. DNA polymerase has evolved to make errors at a relatively high rate because this is what drives evolution. OV.
