The mechanism by which DNA is licensed to replicate only once during each S phase involves ORC and helicase loaders binding to geminin. MCM proteins binding to geminin after replication ORC and helicase loaders being phosphorylated. MCM proteins binding only to replicated DNA. MCM proteins binding only to CEN DNA. IncorrectThe mechanism by which DNA is licensed to replicate only once during each S phase involvesORC and helicase loaders binding to geminin.MCM proteins binding to geminin after replicationORC and helicase loaders being phosphorylated.MCM proteins binding only to replicated DNA.MCM proteins binding only to CEN DNA.0/1 pts

Option A: This option is incorrect because ORC and helicase loaders do not bind to geminin during…

Incorrect The mechanism by which DNA is licensed to replicate only once during each S phase involves ORC and helicase loaders binding to geminin. MCM proteins binding to geminin after replication ORC and helicase loaders being phosphorylated. MCM proteins binding only to replicated DNA. MCM proteins binding only to CEN DNA. 0/1 pts

Incorrect The mechanism by which DNA is licensed to replicate only once during each S phase involves ORC and helicase loaders binding to geminin. MCM proteins binding to geminin after replication ORC and helicase loaders being phosphorylated. MCM proteins binding only to replicated DNA. MCM proteins binding only to CEN DNA. 0/1 pts

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Similar questions

Which of the following statements is NOT TRUE about genomic DNA replication? O A DNA replication begins at the origin of replication and proceeds bi-directionally O B. New nucleotides can be added by the DNA polymerase only to the 3 end of the growing strand O. Synthesis of new DNA is catalyzed by the enzymes called DNA polymerases OD. DNA replication is semi-conservative OE. DNA replication proceeds continuously on both parental DNA strands.
Which of the following statements regarding DNA synthesis at the ends of linear chromosomes is true?
Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.
Which of the following are true about bacterial DNA replication compared to DNA replication in humans (eukaryotes) (select all that apply) Bacteria can replicate their entire genome more quickly than human cells can Bacteria DNA replication uses more types of DNA polymerase than human cells do Bacteria can replicate DNA continuously, but eukaryotes wait for the S phase of the cell cycle Bacterial DNA replication does not require helicases, because the chromosome is circular DNA sequence where replication initiates are rich in A's and T's in eukaryotes, but not in bacteria Bacteria have more origins of replication than human chromosomes do
During DNA replication, one of the new strands of DNA is synthesized continuously, while the other is synthesized as a number of separate fragments of DNA that are subsequently linked by DNA ligase. This is because O replication starts at many points on the chromosome RNA primers only anneal to one of the parental strands of DNA one of the parental strands is unwound slower than the other by helicase DNA polymerase III only synthesizes DNA in the 5' - 3' direction
Labeling DNA Replication Directions: Drag the lahels from the left tn corrary derti theinats of ar=rlicating strandarA 24 Newly Created Strand of ONA Replication Carke Original DNA Strand Replication Direction of Origin of Replication Directions: Bolow is a more in-depth look at a replication bubble. A.l of the psrts are still tne came, but
How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.
Which of the following statements is TRUE? Synthesis of the lagging strand requires more DNA helicase enzymes than synthesis of the leading strand. The lagging strand is synthesized in a semiconservative fashion while the leading strand is synthesized in a conservative fashion. The leading strand is replicated continuously for the entire length of the chromosome, e.g. while the lagging strand has multiple origins of replication The lagging strand has a higher mutation rate than the leading strand. None of the answers are true.
Discuss DNA replication of prokaryotes and please mention all of the enzymes and components listed below. DNA Primase – DNA directed “RNA Pol” which inserts nucleoside triphosphates (NTPs) Primers are oligonucleotides; priming process is the formation of primers DNA Helicase – separates the DNA in advance of the replication fork (in E. coli DNA Helicase II); binds at AT-rich region of DNA; ATP then binds the helicase Single-stranded DNA-binding Protein (SSBP) – no enzymatic activity; does not consume ATP Topoisomerase – alter the supercoiling of double-stranded DNA DNA Ligase – nicking of strands done for replication to continue Okazaki fragments DNA Polymerase – removes primer via 5’ to 3’ exonuclease activity; comes again for 5’ to 3’ polymerization activity (closes the gap between Okazaki fragments) Prokaryotes DNA Pol I – auxiliary enzyme to DNA Pol III; repairs damage; capable of excising pyrimidine dimers; polymerization via single active site that can bind all 4 dNTPs;…
Why are Gyrase inhibitors good antibiotics to use therapeutically? DNA Gyrase is required by prokaryotes, but not eukaryotes, to complete chromosomal replication so it's a good target to inhibit. O DNA Gyrase is required by eukaryotes, but not prokaryotes, to complete chromosomal replication so it's a good target to inhibit. It's impossible to develop resistance against Gyrase inhibitors so they are always effective. O DNA Gyrase is required by both prokaryotes and eukaryotes to complete chromosomal replication so it's a good target to inhibit.
Which of the following statements about DNA replication is correct? Group of answer choices the leading strand is replicated continuously, while the lagging strand is replicated discontinuously on the leading strand, the new nucleotides are added only to the 5' end of the nucleotide chain on the lagging strand, the new nucleotides are added only to the 5' end of the nucleotide chain DNA polymerase works from 3'--> 5' only
Which of the following statements regarding the fidelity of DNA replication is true? DNA polymerase has a 3'-5' exonuclease activity that removes incorrectly paired nucleotides. The DNA polymerase active site is highly flexible and can easily 'fit' incorrectly paired incorporated nucleotides. I. DNA polymerase never makes an error in the nucleotide being incorporated. The stability of base pairing is not a factor in controlling the fidelity of nucleotide incorporation during replication. IV. DNA polymerase has evolved to make errors at a relatively high rate because this is what drives evolution. OV.