Give me nucleotide sequence with pairing. Like this ATC TCA TGA GCC TAG AGT ACT. CGG

Q: Match the primary sequence to its characteristics/function/fate 1. mostly hydrophobic, interacts…

A: Cell signaling is an essential component in the cell biology. The signal transduction is carried out…

Q: Would you expect actinomycin D to be a competitive inhibitor of RNA polymerase? What about…

A: A drug is a chemical substance that is used to treat any pathogenic, physiological or psychological…

Q: Bönus questión: Which of the following statements is FALSE with regard to Bacteria? O 165 FRNA…

A: RNA nucleotides are linked together by 3’-5’ phosphodiester linkages. The three min RNA in all the…

Q: a deaminating agent 5-BU is that can base-pair ike cytosine or like if 5-BU is cytosine incorporated…

A: 5-Bromo Uracil and nitrous acid are mutagenic agents. It means both of these agents cause mutation…

Q: Which protein of ß galactosidase includes a MCS? Alpha fragment 'lac z gene '2lacz gene 'lacz3gene

A: Lac Z gene is found in the MCS. MCS stands for multiple cloning site. This site is responsible for…

Q: How can the two tight junction strands remain even after the disappearance of claudin-4 caused due…

A: Tight junctions are the structures present between some animal cells to prevent the leakage of…

Q: In a eukaryotic cell, which of the following would be true for importin proteins? Select all that…

A: A eukaryote is a type of cell that has a well-defined nucleus. The nucleus of a eukaryotic cell is…

Q: What determines the conformation of Mediator? TAND 1 O TAFS 6 and 9 interactions with transactivator…

A: Introduction In All Eukaryotes, Mediator Is A Multiprotein Complex That Acts As A Transcriptional…

Q: What is mechanism of intein splicing to join P1 and P2 ? Which steps are reversible and which ones…

A: DNA is the genetic carrier that carries genetic information from one generation to another. DNA is…

Q: the genetics behind this

A: Immunoglobulins are also called antibodies. These are essential molecules that are a part of the…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…

A: There are 4  codons that specify the amino acid valine, demonstrating the genetic code  is…

Q: What would be the result of a substitution of TA for the GC at position 10?

A:

Q: You can adhere mRNA to a column using Oligo dT Introns Сар

A: DNA is the center of genetic sequences. The mRNA is formed by the DNA transcription when DNA…

Q: you have isolated a new protein called STICKY. you can predict from comparisons with other known…

A: A new protein named "STICKY" is isolated, which possesses a specific region in its structure. These…

Q: Woite Short notes oo tRN A.

A: RNA is ribonucleicacid which is made up of sugar phosphate and nitrogenous base.

Q: RNAi takes place in... nucleus cytoplasm both

A: Both

Q: Felal hemoglobin comprises of ay sub-units. has been found that the y-chain contains serine at…

A: 2,3-Disphosphoglycerate (2,3-DPG), promotes the transition of hemoglobin from a high-oxygen-affinity…

Q: Predict the sequence of amino acids coded by the mRNA sequence 5’ GGA–GGC–ACA–UGG–GAA 3’

A: The single strand of the RNA molecule, which consists of a gene sequence and carries the message…

Q: t RNA is  3`UAC 5` so m RNA  -5` AUG 3` but why mRNA can not be the 5'GUG'3 based on wobble…

A: Wobble base pair It is a pairing of two nucleotides in RNA molecules that does not follow the rules…

Q: What type of cytopathic effect is seen when rabies virus infects a monolayer of cells? O the…

A: The cytopathic effect of the rabies virus on a monolayer of cells is characterized by the formation…

Q: Please help transfer CAT AGG GAG to mRNA

A: Answer. DNA replication is a process that takes place inside the nucleus of the cell. During…

Q: 3 6 9 12 15 18 21 24 5 -GGGGA GAA CGA G ACA AT C TG C TC G 3' 3' -CCCCT CTT GCT C TG T TA G AC G AG…

A: Nitrogenous bases in DNA are purines and pyrimidines. Purines in DNA are Adenine(A) and Guanine(G).…

Q: WILD-TYPE MC1R GENE (LIGHT COAT-COLOR PHENOTYPE) DNA CGG GAC CGG TGG GCC CAC TGA CAC mRNA…

A: In molecular biology, genetic code defines the conversion of DNA into m RNA and m RNA into its amino…

Q: Which of the following protospacer adjacent motif sequences would be recognized by Cas9?     GCG…

A: Cas9 stands for CRISPR (clustered regularly interspaced short palindromic repeats) associated…

Q: The image below shows four membrane proteins. A вс D Select all amphipathic proteins. A В C

A: There are several proteins are associated with the plasma membrane. These proteins are considered as…

Q: Explain what MRNA is and FRNA is.

A: RNA, also known as ribonucleic acid, is a nucleotide polymer composed of a ribose sugar, phosphate,…

Q: 1 Foundations Cell Molec The first 17 amino acyl residues in human preproinsulin are…

A: Colinearity simply refers to the relationship between the length of a DNA sequence in a gene and the…

Q: Match the letter in the diagram with the accumulation or localization of active (or about to be…

A: ARF- ARF stands for ADP-ribosylation factor (ARF) members of ARF family GTP binding proteins…

Q: During termination, the release factor binds this site  A site E site  P site

A: The translation process in cells includes the synthesis of proteins that are made up of amino acids.…

Q: The sigma factor helps RNA polymerase to bind at the Shine-Dalgarno sequence.

A: Transcription is the formation of mRNA from DNA. It occurs in nucleus. RNA polymerase is involved in…

Q: Identify a protein that can contain a temperature-sensitive mutation that would explain these…

A: The mutation is the change in the nucleotide sequence that can be due to some chemical mutagens or…

Q: Beta-lactam antibiotics work by? O A. cleaving peptide side chains O B. preventing cross-linking of…

A: β-Lactam antibiotics have a β-lactam ring in their molecular structure. They include penicillins,…

Q: TOIC Stimulus EUkaryotic cell mi RNA Protein SUp nucleus Deg target mRNA:

A: The diagram illustrates an eukaryotic cell in which micro RNA binds to the target mRNA which has…

Q: Carbohydrates can play important roles by modulating interactions between proteins. For example,…

A: Thrombin (coagulation factor II) is a serine protease that plays a vital role in hemostasis and…

Q: Look at the figure and predict what would happen if the SRPRNA was unable to stimulate the GTPase…

A: A specific ribonucleoprotein serves the function of recognition and targeting of the protein to the…

Q: Mark promoter and terminator

A: DNA, or deoxyribonucleic acid, is the genetic material that carries the instructions for the…

Q: What is the common feature of RTKS: O cysteine rich domains SS binding of external proteins O…

A: Tyrosine kinase domain

Q: pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: Determine the results of an insertion of TA between positions 2 and 3.

A: 5' GTAGGGAGAACGAGACAATCTG  3' DNA 3' CATCCCTCTTGCTCTGTTAGAC  5'   5'GUAGGGAGAACGAGACAAUCUG 3' mRNA…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.