Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…
A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…
Q: Normal sequence: DNA: MRNA: GGA CCU prline CTC GAG glutamic acid CTC GAG glutamic acid Amino Acids:…
A: Normal sequence: DNA: GGA CTC CTC mRNA: CCU GAG GAG Amino Acids: proline glutamic acid glutamic…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: The central dogma of life can be stated as follows: Replication of DNA to form new copies of DNA…
Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…
A: Gene expression refers to the complex, highly-regulated biological process, which involves the…
Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…
A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…
Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…
A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA. Missense…
Q: If we mutate the anticodon of tRNA™P from CCA to ACC, what would happen? O Tryptophan would always…
A: BASIC INFORMATION TRANSLATION It is the process in which protein is which formed from the…
Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…
A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…
Q: In this sequence there are two introns and three exons. Exon 1 has 3 amino acids, exon 2 has 4 amino…
A: Once a gene is transcribed into a pre-mRNA transcript containing both coding (called as exons)…
Q: Draw a line representing mRNA that has already been processes (introns removed, cap and tail added).…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU…
A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…
Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…
A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of…
Q: A small section of bacterial DNA template (anti-sense) strand has the following nucleotide…
A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur…
Q: A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence:…
A: When a single base nucleotide is changed, it is called as point mutation. Non sense mutation, is a…
Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' 1. Where N stands for any nucleotide, give…
A: *Given DNA sequence is 3'-TACTTNGTNCTNTCN - 5' 1* Here N will be any nucleotide so take Him place…
Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…
A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…
Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT…
A: A small section of a gene for a protein has the following nucleotide sequence that codes for the…
Q: CUGACUGACUGA A template strand of DNA in a gene reads: TGG CTG GGT GCT ACA. GUCAGUCAGUCA Using the…
A: Firstly DNA template strand undergoes transcription process to form RNA. After that translation…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…
A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…
Q: What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5'…
A: Transcription is the process of synthesis of an RNA molecule from the DNA template strand. Where RNA…
Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…
A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…
Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…
A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…
Q: 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Amino Acid 4. DNA (3'-5') AAG GTC…
A: Introduction: DNA: A deoxyribonucleic acid It is the hereditary molecule in the organisms except…
Q: 3. Below is part of the DNA genetic code for six amino acids. TTT AAA Codes for phenylalanine САА…
A:
Q: The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a…
A: Introduction A mutation is a change in the sequence of nucleotides in DNA or RNA. Everyone is…
Q: The exons and introns of a gene are shown below. Introns are shown as black bars. Exons are numbered…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: An RNA produced from a fragment of DNA has the sequence of 5'AAUUGGCU3'. The sequence of the…
A: Genetic information in our body is stored as DNA. DNA multiples itself by replication. DNA is used…
Q: If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its…
A: DNA and RNA are the two types of nucleic acids. Deoxyribose nucleic acid (DNA) is present in all…
Q: In the picture below (representing RNA transcription) match A-E to whether they are 5' or 3' ends. A…
A: The information recorded inside the DNA sequence of one or more genes is transcribed into a strand…
Q: What type of mutation is depicted by the following sequences (shown as mRNA)?Wild type ....5′…
A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…
Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…
A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…
Q: A small section of a gene for a protein has the following nucleotide sequence: GGC TCG GTA ACA TAC…
A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…
Q: Which of the following help(s) to stabilize mRNA by inhibiting degradation? a. Introns b.…
A:
Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…
A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…
Q: What mRNA base sequences are complementary to the following DNA template sequences? Be sure to label…
A: The process by which the mRNA is transcribed from the parental DNA is known as the process of…
Q: Your DNA has been mutated! Carry out the following mutations, separately: a) In the original…
A: Question - Your DNA has been mutated! Carry out the following mutations, separately: a) In the…
Q: What amino acids are specified by the following base triads on DNA? a. TCA b. CCt c. GGC d. GAT e.…
A: A genetic codon is a triplet nucleotide sequence of RNA molecules that were formed from the…
Q: Translocation occurs before peptide bond formation O moves the RNA four bases O moves the RNA three…
A: During the process of translation, when the peptidyl-transferase reaction has occurred,…
Q: When given the DNA message sequence, 5'-ACT-3', what would be the corresponding DNA template strand…
A: In biology, a DNA strand is the double-stranded molecule of nucleic acid that serves as the…
Q: A gene includes the sequence AGAACT. When it is transcribed, what will the RNA sequence be? A.…
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: if the sequence of bases in the mRNA Codons is 5' - AUCCUACGU - 3' then the sequence of amino acids…
A: In the central dogma of molecular biology, DNA is converted into mRNA by the process of…
Q: Give me nucleotide sequence with pairing. Like this ATC TCA TGA GCC TAG AGT ACT. CGG
A: The nucleotides are the building blocks of nucleic acids. The nucleotides are formed of a…
Q: A template strand of DNA in a gene reads: CCA AGC TCT. Using the codon chart provided, what is the…
A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…
Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…
A: AAG ATA CAG GCT CGG TAA : DNA
Q: A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence:…
A: Frame shift mutation/Gibberish mutation It is a genetic mutation caused by loss or addition of one…
Q: What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG…
A: DNA is genetic material which is involved in transfer of information into the protein. It involves…
Q: Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence…
A: The deoxyribonucleic acid (DNA) undergoes the process of transcription for synthesizing the…
Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…
A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…
Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical…
A: Codons are made of three nucleotides of DNA or RNA. Each codon codes for an amino acid. The amino…
t RNA is 3`UAC 5`
so m RNA -5` AUG 3`
but why mRNA can not be the 5'GUG'3 based on wobble pairing rule.
THANKS
Step by step
Solved in 2 steps
- 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this 3’-GTCGTATAGTGA-5’, give reason if it not correctWhat’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’
- Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU GCC AUU GCA GCU AAA CAC UUC GAG CCC UGU- 3’ What is the polypeptide sequence?RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
- 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.Arg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q
- Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…G TATC| 3' DNA Double Helix T G A G G MRNA CAU tRNA anticodon VAL ASN VAL Amino Acid 2) Label the coding and the template strand in the table. AV S X It F3 3 9999999 E D G Which letter indicates the amino end of the growing polypeptide? с F4 $ 4 A Q Search R F mRNA F5 er ge % UAC 5 V T F6 GGG AUGCCCACG G 6 B Y De F7 H ►/11 v lo & 7 7 F8 U 4 N UAG * 8 865 F9 8 1 5 G Мо Alt F10 ( 9 9 K 2 O < " ) 6 0 F11 1 P* L 3 • V A 30 F12 ; { I Ctrl = 332 PM 4/7/2023 ? + 1 } 1 11 A 1 G Backspace Home Delete Enter Shift PgUp PgDn
