fill in the blank: 1. The expression of a gene, its pre-mRNA can undergo   , resulting in multiple mRNA isoforms encoding variants of protein products. 2. ___________  and                       are two widely used technologies in whole transcriptome profiling, to quantify the                     abundance of RNAs of expressed genes. 3. Whole transcriptome profiling using _____________ does not require prior knowledge of genome sequences. 4. Next generation whole transcriptome arrays (WTAs) contain comprehensive DNA probes allowing detection as well as quantitative measurements of all expressed RNA species, by assessing the p-values at both  _____________    and _____________.

Q: Provide 3 most applications/purposes of DNA analysis.

A: Recall that: DNA is the genetic material passed down from one generation to another, ie, the…

Q: A mutant monkey was identified that showed resistance to a viral disease 'Kansah'. The kan gene,…

A: In molecular biology, PCR (polymerase chain reaction) plays an important role. With the help of this…

Q: Genes whose expression is easy to assay are called: Group of answer choices Functional Genes…

A: The study of gene expression of a cell or tissue at a time to know more about the gene products and…

Q: (-) A B C DEF G TE G Developmental Stage Legend: A- 1" instar D- 4 instar G- adult B- 2nd instar E-…

A: Electrophoresis is the technique to isolate various band sizes of DNA (deoxyribonucleic acid),…

Q: Is methylation a reversible process? Explain your answer. 2. What potential does epigenomics…

A: Methylation is a biochemical process in which a methyl group (-CH3) is added to a molecule,…

Q: Occurred in her cells? (Unfortunately her parents have passed away.) I think these genes are…

A: CRISPR stands for Clustered regularly interspaced short palindromic repeats. It is a system of…

Q: What is the name of the regulation of genes in response to the environment Briefly describe two ways…

A: The process is known as regulation of gene expression . It includes a wide range of mechanisms which…

Q: True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2.…

A: Polyhistidine tag is added to a protein and helps in its purification. A recombinant protein can…

Q: human populations for part of the β-interferon gene that can easily be scored using PCR…

A: Gel electrophoresis is a technique of DNA separation in which fragments are separated on the basis…

Q: Match Column A with Column B F. v Analysis of genome-wide patterns of gene expression F. v…

A: Recombinant DNA technology - It is a technology which forms the desired DNA sequence of interest by…

Q: Explain an example of a successful gene therapy trial. In your answer be sure to consider: a…

A: SCID is a genetic disorder caused by numerous genetic mutations which are characterized by the…

Q: 6. Explain why a positive test for COVID19 would appear sooner than a negative result when using…

A: While studying the global pandemic it is assumed that approximately 300,000 children or more might…

Q: Below is the genotyping results using PCR and gel electrophoresis for a DNA-binding regulatory…

A: The transcription factor is responsible for binding to the promoter. It leads to proper binding of…

Q: 5. Which word describes the majority of permanent genetic mutations? a. Helpful b. Minor c.…

A: Mutation in a gene is a permanent alteration in the sequence of the DNA that makes up a gene so that…

Q: Correctly match the material/supply to its role (job) in genetic engineering. vcuts gene and…

A: Answer 2. The correct match and its role (job) in genetic engineering is 1. Cuts gene and recipient…

Q: 1. Describe the difference in the bands for the PCR and RT-PCR from the CD4+ T cells (ie. Make an…

A: PCR is a biochemical technique that is used for target-specific amplification of DNA. dsDNA is…

Q: the context of this image is that it is from the GEO website and what to do is to write 500 words…

A: Breast cancer is the most common malignancy in women globally, accounting for over 30% of new cancer…

Q: B. Genome Mining 1. Using the sequences from the previous activity, identify the organisms to which…

A: DNA sequencing - DNA sequencing refers to the general laboratory technique for determining the exact…

Q: • Part B a cotransformation experiment, using various mbinations of genes two at a time, the…

A: As you perform an experiment in which another Gene g was studied and it demonstrated positive…

Q: 1- To generate a sequencing library of transcriptome, the cellular    is converted to a…

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: Question 2. Which laboratory method can be used to quantify levels of all mRNAs expressed in samples…

A: RNA sequencing or RNA-seq is a powerful laboratory method used to quantify the expression levels of…

Q: .. Describe how mutations are linked to DNA polymorphism

A: Note: Sorry, Please note that as per our company's honor code, we are not allowed to cite external…

Q: 5. Consider the use of GWAS to identify mutations that contribute to an increased risk of pancreatic…

A: Cancer is a highly fatal disease that may occur due to the exposure towards high ultra violet rays.…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: Enumerate the steps involved in gene cloning and the protein/enzyme requirements for each step. Just…

A: The technique of creating numerous, exact copies of a specific portion of DNA is known as DNA/gene…

Q: the one that says (what biotechnology method is used to create the figure)

A: Sanger sequencing is a technique for DNA sequencing dependent on the specific joining of…

Q: please select the gene type is INCORRECTLY matched with its type of genomic sequence. 1. TRNA gene:…

A: The answer is given below,

Q: Let's Apply Instructions: Classify the genetic modifications mentioned below according to their…

A: Genetic modification can be done by using Recombinant DNA technology or Genetic engineering.

Q: Fill the blanks.    1. Mutations in a GC box in the 5' upstream region from the protein coding…

A: 1.  Mutations in a GC box in the 5' upstream region from the protein coding sequence of a gene would…

Q: 1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: What is genomics? Lüffen birini seçin: O a. the study of entire genomes, including the complete set…

A: Genome It is defined as the complete set of genetic instructions of an organism. Each genome…

Q: Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind…

A: It is difficult for one to to find out gene of interest out of a complete genome. However, a given…

Q: An EMS mutagenesis screen identified several mutants in this gene. The figure shows the position of…

A: "As per the Q&A guidelines, we will provide the solution to the first question. Please repost…

Q: RNA sequencing can detect DNA mutations typically easier to analyze can detect transcripts with very…

A: Microarray technology is used to measure the expression levels of thousands of genes simultaneously,…

Q: What is your epigenome (i.e. epigenetics)?

A: The genes are formed by the Deoxyribonucleic acid (DNA) of an organism. These genes code all of the…

Q: assess anatomical distribution of gene expression.   genomic pcr nortbern blotting Rnai in situ…

A: The genes are the functional part of the DNA that undergoes transcriptional process and ultimately…

Q: 8. Which of the following is the most common way in which a genetic mutation occurs? a. Point…

A: Mutations are changes that occur in the genetic material of an organism such as DNA or RNA. These…

Q: anatomical distribution of gene expression can assessedby...... in situ hybridization   rnai…

A: A northern blot is a lab technique for detecting individual RNA molecules in a mixture of RNA…

Q: Please find the attached file.

A: Ames test is used to test for a mutation causing the ability of a chemical in the DNA…

Q: 1. Genome annotation refers to all of the following except a. assigning a unique identifier given…

A: 1. Genome annotation refers to all of the following except  Answer: e. All of the above are correct…